Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1260
Length(NT) : 1069
Best Gene Model Blast : Link to GSTUMT00007755001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: COP9 signalosome complex subunit 2
Accession: ref|XP_001217336.1| Score: 1103 E_value: 1e-118
KEGG Definition: COP9 signalosome subunit 2 (CsnB), putative
Accession: afm:AFUA_3G06700 Score: 1101 E_value: 1e-118
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG1464 Score: 960 E_value: 1e-104
PFAM Definition: PCI, PCI domain. This domain has also been called the PINT motif (Proteasome, Int-6, Nip-1 and TRIP-15)..
Pfam Number: pfam01399 Score: 247 E_value: 7e-22
Swissprot: Q5B3U7|CSN2_EMENI

Sequence:
>Contig1260
TTGGCGAAGCTGTGGCTCGATAGGAAGGAATATGCACGCCTTCAGAAGAA
CATTCGTCTTCTTCATAAAGCCTGTCAGAGACCTGACGGCAGTGATGACC
CCTCTAAAGGAACTTATCTTCTTGAGGTCTATGCCATTGAGATACAAATG
TATTCGGAGACCGGGAATAATAAAAAAATGAAGGAGCTGTATAATCAATC
TCTGCGTGTCCGCTCTGCTGTGCCCCATCCAAGGATCATGGGAATTATTC
GGGAATGTGGTGGGAAGATGCACATGAATGAAGAAAACTGGAAGGAAGCT
CAAAGTGACTTTTTCGAGGCATTTCGAAACTACGATGAAGCTGGCTCGAT
CCAGAGGATACAGGTATTGAAGTATCTCGTCCTAGCCAGTATGCTTATGA
AGTCGGAGATCAATCCTTTTGAATCTCAAGAGACTAAACCATATAAGTCA
GACCCTCGCATACAAGCTATGACGGACCTTGTAGAGGCTTACCAGCGCAA
CGAGATCCACCGTTACGAGTCGATATTGGAGACTCACAAGGCTGAAATAT
TATCGGATCCCTTTATCCGCGAACATATCGACGAGGTTACTCGCAACATC
CGTACTGAAGCTCTCTTGAAGCTTATTGCCCCCTTTACCCGATTCACCCT
TGACTTCATTGCCAGGCAGCTTAAGATACATGTCGCAGAGGTCCAAGAGA
TCTTGGGATTTCTTATCCTTGATAAGAAGATACGCGGAAAAATTAACCAG
CAGAAGGGCACGATTGAAGTTGAGGTTAATGTCGATGCCGAACGAATGAA
GGCAATGAAGGATTGGTCCGCTGCCCTAGGAGCTCTTTCCTATTCCCTCT
TTAACGATGGCGATGGTTTCAAGAGTGATGACGCAAGTTTAATGGGTGGC
ATGGACGTGGGACGCCGGCGCATGTGAGGCCACGATAGAACTGATACGGA
GTTTGAATCAGGTTTGACATGGAATAAAAGAAAAAAATCTTGTAGCCTCT
TAAATCTGCAGTTCTTAGTTAATCTCCTGCTCTTGTTCGAGCCAATCGAC
TTTGACGTTTCCCTTTTTC

Sequences in the Contig:

SY0AAA20YJ02RM1 SY0AAA45YP01FM1 SY0AAB59YH11FM1