Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig126
Length(NT) : 787
Best Gene Model Blast : Link to GSTUMT00007728001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_09505
Accession: ref|XP_001239884.1| Score: 293 E_value: 8e-25
KEGG Definition: RNA pseudouridylate synthases
Accession: aor:AO090102000227 Score: 260 E_value: 3e-21
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1919 Score: 215 E_value: 2e-18
PFAM Definition: No Hit Found
Swissprot: Q12069|YDL36_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005634 = Cellular component: nucleus
GO:0016439 = Molecular function: tRNA-pseudouridine synthase activity
GO:0031119 = Biological process: tRNA pseudouridine synthesis

Sequence:
>Contig126
TTGGGCGTATCATACCGGTAAAGCATTTGCACCCGAGCACAATGTCACGA
TAATACATAGAAGGGGGAAAGAAGAAGAAAAAGGCGAGAAGTACCCTCAC
TTGTATGCATCCAAAAATCAACCTCCTCATAACACTTCGAGAACTCGTCA
ATATATCTCGGAGAAAGTACGCCATGGATACCTTACCTTTTAAATCATCT
CCGGGTCTATCCCCAATCGTATTTGGCTCACAAGAGGAAGTAGAAAAGGG
GCCGTCCTCGGCCTCATCATCATCGTCTTCGAAGGCGGGGGAAGGACAGT
CGACAAAAGGGAGGGTATCGGTGCCAATGGTTGCGCAGAAGGACACTGCG
CCCAAACCACCAAAGTTTGTGAACCCGCCCCCGGTGCCGCAGTATTCTTT
CGAGGACGGGTTGAGAAGGGTGCCACCATATCAGTTTTCGTATAATACCT
ACTGTAAGGAGCGGTGGAGGGGGAAAGGGGTGTTGGAGGTGTTTTGGTCA
GAGTTTCGAGACCGGCCGCTGGAGTACTATAAATCAGCAATAGAAAGAGG
CTCTATAAGGATTATTCGTAGGGATAAGAATGGGGCGGGGCCGGGCATTA
AAGGGAGGAGGAACAACAGTGAGGTGAAGCAGGGTACTCATGAGGGGATG
AATGGCGGCGGGGCGCAGTTGGCCTCTATGCAAACCATCATTGCGAGCGT
GGACTCGAAGCTCGAGAACGGGGACATGCTTGTACATACACTCCACAGAC
ACGAGCCTCCTGTGACGGCGAAACCAATTGAAACGGT

Sequences in the Contig:

SY0AAA14YL02FM1 SY0AAA52YC07FM1 SY0AAC15YG11FM1
SY0AAC41YE10FM1