Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1259
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00011193001 E-value : 1e-117
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1259
TTGGGTGGGAAGGACCCACTGCCCAGTGGGTTGGGTATTCGTGAGAAGAT
CGCCGCGGCGACGGAGCGGCGTATACGTGACTCGCAGACTTGCGGCGCTG
GGAGCGGTGCTAGGGATAGGGGTGCTATGGAGGCAGAGGCTGAGAGGACG
ATCCGTGCCGGGACCGTCACGGTTGGCGAGGAGGAGGAGGAGGAGGAAAC
AAAACAGGAGGTGGTGGTGCTAGACGAAGACCCGGAAAACGAAGCGGCAA
TAATGAATGCTGCGATAGAACTGATCCAGGAAGCGGAGCGTGAGGAAGCC
GAGCAGAAGCTACTCTGGGAGGAACAAGACGGCATAGTCTGGATTGTAGA
CGATGAGGACGGTCCGATACAAGTCGAACTCCCTCCCGCTGCCGCCACCA
CTGCCGCCACCACTCCCTCTCCCCCACACCCCCGCATCCCGGCACCAATA
GTAATCACCTCCTCCCCTCCCCCCCCACCACCTGCAGAACCTCAAGACCT
CCCCCCAAGCTACGAACAAGCAACAACCTGGGCCTGTGACCTCTGCACTT
TAATCAACCCCTCAATCCTCCCCCGC

Sequences in the Contig:

SY0AAA45YL16FM1 SY0AAA45YO12FM1