Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1258
Length(NT) : 712
Best Gene Model Blast : Link to GSTUMT00011894001 E-value : 1e-161
Numbers of ESTs : 8

Blast Results:

Nr Definition: HS30_EMENI 30 KD HEAT SHOCK PROTEIN
Accession: ref|XP_661159.1| Score: 356 E_value: 3e-32
KEGG Definition: 30 kD heat shock protein
Accession: ani:AN3555.2 Score: 356 E_value: 2e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0710 Score: 176 E_value: 7e-14
PFAM Definition: HSP20, Hsp20/alpha crystallin family..
Pfam Number: pfam00011 Score: 164 E_value: 2e-12
Swissprot: P40920|HSP30_EMENI

Sequence:
>Contig1258
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCGAAAACTTCAAAGCTCT
CTCCAAAAGCACTTTCAAACCTTACCAAAAATCTCCCAAACACCATTTCA
AAAAGCATACTTCGACAAACCACAAAAACGAGGACAAAATGTCGCTTCTA
AGGCAATACTCTGATATCTTCAGTCTCCTTGACGATACCTCTCGCATACC
CCAACGCACCAACCGCCGTGGTGCCTTCTCCCCAAGCTTCGACGTTCACG
AAACGGAACAAGCCTACGTCCTCGAAGGCGAACTCCCAGGACTCCACGAT
AAGTCGAACCTAAGCATCGAGTTCACCGACCCCCAGACACTCCTCGTCCG
CGGCAAGACCGAACGCCTTCACCAGGAGTCCTCGGACAACGAACCCGCCA
TCGCCAAGAAAGACAAAAAAGAGGTCCAGCAAGAAGCCAAGGGTGCCATC
GAGGAGAAGGATAAAGATTCCAGGCCCCGCTATTGGGTTTCGGAGCGCAC
GGTCGGCGAGTTCCAACGCAGCTTCTCGTTCCCGAGTTATGTGGATATGG
ACGCCGTGAAGGCTAGTCTTGCGCATGGGATTTTGAAGATTGTGGTGCCG
AAGAAGCAGAGCCAGATTGCGAAGAAGATTGAGATTTCTTAAAGTGCATC
GGGATAGTAGGAAATTGTGATTTAGGATGGAGCTCGGGGGAACGGTGGAT
TGATTGTCTTGC

Sequences in the Contig:

SY0AAA13YD24FM1 SY0AAA45YO03FM1 SY0AAA47YD14FM1
SY0AAA54YF16FM1 SY0AAB37YK02FM1 SY0AAB54YP21FM1
SY0AAB55YP22FM1 SY0AAD40YD02FM1