Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1257
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00010454001 E-value : 8e-24
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1257
TTGGCTAGCATAGGATAGATGGGACGGTCATCAATACCACAGCCGTTAAA
CGCCGCCATCGTTACCACTCACTCCAAGACTCTACATTCCATTACTACAT
TACCATTCCTGAAAAAAACAAGAGATTTACCAACATTATTATATCAAAAG
ATGGATAATAAGGATACCGTGTGGCCTTCGTCCGTCACCTTGGTGGTCAG
CCATCTCGTCGCTCTCTCTTATACATCCATCATCGCTCGCTACTTTGTTG
AGGCTCAAACTTATAGTGGATGGGTCTGCTTCTCATGTGTAGTCACTGTC
AGCCTTCTAATTGCTGGAAGCTCAGCACACCTTTCGGATATACTTGACCT
CATGGGTTATTCACTATGGAAAGAACCCCTCTGGGTGATGGCATGCAATA
TAGGGGTTTTCTCCTGTGTGCATTCCATTTACCTGATCACCAGGACGGAA
TCGGGAACCGTTTCGGATACGCCACCTCCTCGCAGTTCATTCCCAGGTCC
CGAGGAGCTAGATAGAGGCGAATA

Sequences in the Contig:

SY0AAA45YN07FM1 SY0AAB33YA04FM1