Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1256
Length(NT) : 3083
Best Gene Model Blast : Link to GSTUMT00010228001 E-value : 0.0
Numbers of ESTs : 35

Blast Results:

Nr Definition: nitrate reductase
Accession: gb|AAN64993.1| Score: 4269 E_value: 0.0
KEGG Definition: niaD; nitrate reductase (NADPH) niaD-Aspergillus niger [EC:1.7.1.3]; K10534 nitrate reductase (NADPH)
Accession: ang:An08g05610 Score: 2736 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0535 Score: 908 E_value: 5e-98
PFAM Definition: Mo-co_dimer, Mo-co oxidoreductase dimerisation domain. This domain is found in molybdopterin cofactor (Mo-co) oxidoreductases. It is involved in dimer formation, and has an Ig-fold structure..
Pfam Number: pfam03404 Score: 489 E_value: 2e-49
Swissprot: P36842|NIA_LEPMC
Gene Ontology:
GO:0050464 = Molecular function: nitrate reductase (NADPH) activity

Sequence:
>Contig1256
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGATCCGTTTCTAGTAC
ATTTTTGCTAAAGCTCTCGGGAAACACCCTAAACTTCACTGAGATTCCTC
ACGCAACGACAATTTTGTGTTTAGCTCAATATACCAGTTGAAAATGAACA
CCCTCGACACTGTTTTTGGATGGCTCTTGAGCCTACTCTCTCTGATCCGA
TTTTTCAGGACGACGAAGAAATTGGTTATTGATGGCACTACTTCCTCTAT
CAGCATTCCCAACGTGGAAACAAATCCTCATATACCTCCAAGCAACGCTT
TCCTAGGGAATCCGAACCAATTAGCTCCACCGACTCCCCCGGAGTCGGAC
AAAGGCGACGATGAATGCGATGATTTGGAAAATATACCACTTCCGCCACC
GTCAGTAAACCCAACAACCGTCCTTGATGTCGATGTTGGAACGCCGGATT
CACATGTCCCCAGGGACCCAAGATTGATACGCCTAACGGGAGTGCACCCA
TTTAACGTTGAGGCACCTCTTTCGGCATTATTTGACTCTGGATTTTTGAC
CCCTCCGGAACTCTTTTATGTCCGAAACCATGGAGCTGTTCCAGAAGTCC
ATGACGACGAAATGCTGGACTGGACAATAACGATCGAAGGGTTGGTAGCC
AACCCCCTGGCTTTGACCTTACGTCAAATCATCACCGGATTCGAACAGGT
TACTCTTCCTGTCACTCTTGTCTGTGCAGGTAATCGTCGAAAGGAGCAAA
ACCAGGTTCGAAAATCTCAAGGATTCTCATGGGGTGCTGCGGGTGTCTCC
ACGTCGCTTTTCACAGGCCCACTTTTGGCATCCGTTATTGCCGCTGCAAG
GCCCCAACGAAACGCCAGATATCTCTGTATGGAGGGGGCAGACGAGCTTC
CAAACGGGAATTACGGGACTTCCATACGTCTTTCTCAAGTCTTCGATCCC
AATCGCGGAATTATGCTTGCGCACAAGATGAATGGCGAGGAACTTCGCCC
TGATCACGGGCGTCCCCTCAGAGTGGTTGTTCCATCTATGATTGGTGGGA
GATCTGTAAAGTGGTTAAAGAAGATCATACTCACGGAGTCGCCGAGTGAG
AACTGGTATCATATCTACGATAACAGAGTTCTGCCAACTATGGTCACACC
GGAGATGGCCAAGGCGAACAAGGACTGGTGGACCGATGAGCGGTATGCGA
TTTATGATCTTTCTGTTAATTCAGCGATTGCATATCCCGCACACGACGAG
ACACTGTCGATGGAGACAACAAAGGAACAGTACAATCTGAAGGGTTACGC
CTACGCTGGGGCTGGGAGGAGGATTACTCGTGTTGAAATTTCCCTTGATA
AGGGCAGAAGCTGGATTCTATCCTCGGTAGAATATCCGGAGGACCTGTAC
CGATCTATTCCTGAAAATGCCACTCTATTTGGAGGTCGCCTCGATGTTGG
CTCGCGAGACGCCTGTTTGTGCTGGTGTTTTTGGTCTCTGGATATTCCTA
CCTCAGCCTTGTTTGCTGCGGATGATATCGTTGTTCGAGCCATGGATGAT
AGCATGAACACCCAACCAAGGGATACCTATTGGTCGGTATTGGGGATGAT
GCACAATTCATGGTTTAGGGTCGCAATCCGTAAGGAAAACGGCCGTATTA
GATTCGAACACCCCAACCAGCCAGCACTGCTAAAGGGTGGATGGATGGAA
AGAGTGAAAAAGGAAGGGGGCGATCTATTGGGCCTTAATTGGGGTGAGAG
GGTGATGGGAGAGGAGTCTGTTGCTGGTGGGGCTACCAGTGCTCCGGAGG
TCCGAGACACCGTGAAGATGACGGATGATTCCGTGCAAAGGACAATTGAG
ATCGAGGAACTTAGGGGCCACGACAACGCCAGTGAGCCATGGTTTGTAGT
CGAAGGTGAAGTGTATGATGGAAAACCTTTTCTTGAAGAACATCCGGGAG
GGGCGACAAGCATCATATCCGCTGCCGGACAAGATGCAACTGATGAGTTT
GTGGGGATTCATAGCGAAAGCGCAAAGGCGATGATGCCAAAATACCATAT
TGGTACGCTAAGTGCTACGGCGCGTAAACTTCTTCTTGAGCCGGCCGCAC
CATCCAAGAAGGGACCCTCAGAAACATTCTTGGATCCACGAGCATGGTGT
CAAGCAGCCCTAGTGCAGAAAAAGGTGGTATCATGGGATACTAGAATTTT
CACCTTCGAACTCGATAATCCTACACAAACACTAGGTCTTCCCGTCGGGC
AGCATCTTCTCATCAAGATACGGGACGAAAAGACCGGAGAGGTGATTACG
CGGCCGTACACTCCCATCTCATGTAACACTGAGAAGGGTGTTGTTCACCT
ACTCGTGAAAGTATATTTCGATACACCAACCGCTCTTGGTGGAAAGATGA
CACAAGCTATGGACAGGATGCAAATGGGTCATACCGCTTCCTTCAAGGGT
CCCATCGGTAAACTTGTATATCATGGGCAAGGTGTCGTTTCTCTCCTTGA
CAATCGGATCAATGTCACATCATTCCTTATGATCTGTGGCGGAAGCGGAA
TAACTCCCATTTTCCAAGTCCTCAGGGCAGTCCTTTCTGACCCTACGGAT
TCTACAACGTGCGTTGTCCTCGACGGGAACAGAGCAGAGGAAGATATTCT
GTGCCGAGAGGACTTGGATTCGTTCGCAGCGACATATCCGGAAAAGTGCA
AGATCGTTCACACTCTTTCAAAGCCCTCAGAGCGGTGGCAGGGTGAGAGG
GGCAGAATTGGGTGGGATCTGATCAAGCGGAATTATCCACAAGGCTGCGA
GGGCCGTAAACCCTTAGCACTAATATGTGGGCCCGAGTCATTGGAAAAGA
GCGTTAGGGGCCTGCTAACAGCCGGTGGGTGGGGGGAAAGTGATATGGTA
TTTTTCTAGGCGCTTTTCTTCTTTTTCTTTCACCGATGTTAGACAGATTT
TGTAGATTTGGGTTTATGGTCATGGCTTTTGGTTCTTTTTTCTGCAAATA
TTGATAGCATTAGAATTAAAGGTTTTAATCCTC

Sequences in the Contig:

SY0AAA28YJ10FM1 SY0AAA33YM15FM1 SY0AAA43YC05FM1
SY0AAA43YP09FM1 SY0AAA45YA19FM1 SY0AAA45YM20FM1
SY0AAA46YF11FM1 SY0AAA49YB14FM1 SY0AAA49YE06FM1
SY0AAA52YK14FM1 SY0AAA54YP03FM1 SY0AAA54YP15FM1
SY0AAA55YI23FM1 SY0AAA57YF22FM1 SY0AAA58YL20FM1
SY0AAA7YB07FM1 SY0AAA9YF18FM1 SY0AAB10YC09FM1
SY0AAB11YI01FM1 SY0AAB18YF07FM1 SY0AAB18YK09FM1
SY0AAB23YI04FM1 SY0AAB24YM18FM1 SY0AAB27YO08FM1
SY0AAB2YO13FM1 SY0AAB39YK20FM1 SY0AAB42YI18FM1
SY0AAB42YK04FM1 SY0AAB50YD13FM1 SY0AAB52YL01FM1
SY0AAB53YC01FM1 SY0AAB54YE03FM1 SY0AAB54YJ14FM1
SY0AAB59YH01FM1 SY0AAB61YL24FM1