Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1255
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00008154001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: PMP20
Accession: emb|CAA05528.1| Score: 450 E_value: 3e-43
KEGG Definition: pmp20; hypothetical protein [EC:1.11.1.15]; K03386 peroxiredoxin (alkyl hydroperoxide reductase subunit C)
Accession: spo:SPCC330.06c Score: 450 E_value: 2e-43
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0541 Score: 425 E_value: 7e-43
PFAM Definition: Redoxin, Redoxin. This family of redoxins includes peroxiredoxin, thioredoxin and glutaredoxin proteins..
Pfam Number: pfam08534 Score: 285 E_value: 1e-26
Swissprot: O14313|PMP20_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006950 = Biological process: response to stress

Sequence:
>Contig1255
TTGGCGTACAAGCACCAACAAACACATTCCCGAACTTTCACAGAAACTTG
TTCCAATTCATCATGATTTCAGTCGGCTCGTCAATTCCTGCTGCCCCTGC
GAGCCTCTGGGTTGAGAAGGATAATAATACCGTCTCGCTCCCATCCAGCG
GAAAGTACATTATCGTTGGTGTGCCAGGAGCCTTCACTCCTCCTTGCTCG
TCGCATGTTCCTGGATACGTTGAAAACTACGACAAGCTTCAGGCTAAGGG
TATCAGTGCTGTTTACGTTGTCGCCGTTAACGATATTTTCGTCGTGAACG
CTTGGAAGGAGCAGCTTGCCAAGGGCTCTAGCGTCCATTTCCTTTCGGAT
TCCAAAGGCGAATTCACTAGATTGGTTGGGCTCGATTTTGATGCCAGTGG
ATTGCTTGGAAACGCACGCTCCCAGAGATACGTCGCCGTCGTTGAGGACG
GAAAGGTCACCAACCTTCAAGTCGAGAATGAAGCCCCCAACATCACTGTC
ACCCATGTAGACAAGATTCTCAGCAGTTTGTAAAATGCGGAGAACATCTC
ATACGGTAGTTTAGCCACTTTAGCCTGAAGGCTGGTTCGACACAATAAAA
ATTAAGCATACGTCTTGACTATGCAAGTCGCGATTTGTTAAAAA

Sequences in the Contig:

SY0AAA45YL18FM1 SY0AAD43YF20FM1