Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1253
Length(NT) : 1375
Best Gene Model Blast : Link to GSTUMT00008228001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64923.1| Score: 389 E_value: 1e-35
KEGG Definition: NADPH:quinone reductase and related Zn-dependent oxidoreductases
Accession: aor:AO090011000419 Score: 389 E_value: 7e-36
KOG Definition:
Classification: [Energy production and conversion, General function prediction only].
Kog Number: KOG1198 Score: 254 E_value: 1e-22
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 156 E_value: 3e-11
Swissprot: P54006|TOXD_COCCA

Sequence:
>Contig1253
TTGGACCACTTCCTTTCTTTCTCTCCCTCCTTGATCCTTTCAATCCTTCA
TTTGTACTGTACAAGCATACCATCTGCCCTACCTGACCACACCGGAATAT
ACGAGCCTCGCCATTACAAATGACACGAACACAAACGGAACCCCCCCCCC
TACTGCGGGGAAGTGCAGAGGACGGAGTAAGGCAAGAAGGACCAGATCCT
AGCTCAACTCCAACTATATCATGCCGTACCCTACATGAGCCAGACCGGAC
AGAAGGACGGAAAGCTATATAAACCGCCTTCTCAATCGCCAAACATCAAT
TCGCCATGAGAAACCCTACTTCCAGAGCAGCGCACAGCGACAAGAAGCAC
CACGACTCCCTCTATCCCTTCCGCAAGATCTTCATATCTATTTGCACACT
AAGCGTTCTCGCCTACGCACTCTACTACAACTCCACCCACGACAGCTTGA
ACAACACCAGCAACATGTCGGAAGCAGCATACATCCCCGAGGCCAAGGCC
CCTCTCGTCGTCGAGAAGACTGAAATCCCAACGCTCGGGGACGGTGAAGT
GCTCATCAAGAACGAGGCCATCCCTCTCCAACCCATCGACGCAAAGCAAG
CCCGCATCGGTTTCATCCCACTAAAGTACCCGGCAGTCCTTGGCTCAGGC
GTCGCCGGCACAGTCGTCGAGTCCAAGAACCCAAACTTCAGCATGGGCGA
CCGAGTCCTCTCCAACACGCCTGCTTACGGAGCCGGCGATAACAAATACG
GAACTTTCCAGAAGTACACTGTCGCCACCGACCTCACCCTGAAACTCCCC
GACAGCGTCACCTTCGAGAAGGCCGCCTCACTGGCCGTCAACGTCCCCGT
CGCATACTCCTCCCTCTTCGTCGGCCTCGACCTACCCAAGACTGCTCCCA
GCGGCTCCGCCCCCCTGCTCATCTGGGGAGGAAGCACCTCCGCCGGTGGG
TACGCCATCCAACTCGCCATCAGAGCCGGCTACACCGTCGTGACCACCGC
TTCCACGCACAACCACGCATACGTAAAGTCCCTCGGCGCGCAGAACATCT
ACACCTACGACCAGGCAAAGGAGATCGCCTCCCACGGCCCATTCGCCGGA
ATCCTCGACAACGCCGGAACCGGTGCCTCGCACGCCGCCATCTGGCGCGT
TCTCCAGGAATTGCAGGGGAAGAAGGAGGTTGAGGGCACCATCCTCTCGC
TACTGCCCAGCATGGGCACCCATTGAGGGATGGCCGGCAAGCTTGCTCAT
CAAGTTCTTCACCTACAACTTCTCCGAGGAGCCGGCCAAGGAGGAGAAAC
AATACTTTTGGGCTCCAGGCGGGTACTACTCCAAGCTTGTCGCTGAGGGC
ATCATCGAGACCCCGGTCGAGGTTC

Sequences in the Contig:

SY0AAA45YH17FM1 SY0AAA45YL10FM1 SY0AAB42YI12FM1
SY0AAC20YN01FM1 SY0AAC27YB06FM1 SY0AAC56YB02FM1
SY0AAD30YA08FM1 SY0AAD30YI12FM1 SY0AAD34YJ22FM1
SY0AAD43YF15FM1 SY0AAD45YL18FM1 SY0AAD5YM17FM1