Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1252
Length(NT) : 1727
Best Gene Model Blast : Link to GSTUMT00004624001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR06022.1| Score: 162 E_value: 4e-09
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1252
TTGGGGGGACAACTTTGGTACAAAAAAGTTGGTACACACCCTGCTCAAGC
GCTATGGCGGACCACTACAAAAAAAACCAAAGCAAGCACAATATAGGCTT
TTATATAAAGAAAAACAAAAGATTCCACAGGATCATCAATCCTGTATCTC
TATCTCCTTGCCCTGTCCGCCTGCATTCCAATCCTCACTCCACAGCCCAT
CCAATTTAAACTCTTCAGCCGACTCTTGAACAATCTCTTTCCGCTCGTCA
GTCATTATAGCAGCGGTAGCCCGCTTAACACCTTGGTAGTCGTAAGGACC
CCGGTTGGGGCTGAGGATATTCTCAGAGCCGCTAAAATGAGATTTGGTTG
CGACACGTAGCTTGTTACGGATTTTGGCATACTATGGCCACGTTGGCAAC
ATCCTTCTTGCCACAACCCATTCTTCAACTTCTATCACGTTGGCAACACC
CTTCTTGCTACAACCCATACTTCAACTTCCATCACCGAACAAGTCCTTAA
AAGTCTACAGTTCACCAAATTCAGGGACACACCTTTCAAATACCATAAAC
ACGATGCAGCAAGATATGCAAGATCTGTACCACGAGTTGTGGGGAAAGTT
ATCCCCCGTTGTCCAGGAGTTCACAGTGAATGTTCCTGTTGCAAACTATG
GTATCCGGCCTGGATACAAAATCCCCTTGGAATCGACCGCAAGCAGCAGC
AGCTTCAACCCCCATAGTTCATTGAAGTCGAAACGGCAGGACCAGCTATT
CCGGATAGTGGCTGTTGATTCACGTTTACCCTGTGGAGTCCACAAGTTAC
TGGTTCGGTCCGAGTACGATGCGGTGCGCAATAGGTTAATAGAAGTTGAG
GGGAGAAGATGGTCGGGGGCTCGCCACCGGGAGAACCCCACCGCCCGTTG
CAGGCTAGATTGTGAACTCTCAGGTCAGCCTGGTGTAGGAAAAACCTATC
TTCTCTCCTATCTTCTAGTACGCAGACTGCATGATTCCCTTCCCACCATA
TACAGGATAAACGACAACATGTGTTTCCTATTCGACGAAGACTCAGCTGG
GGAAGAGACTAGCATGCAGGCGCTATCTCGGCTGACACAAGAGAAGAAGC
GAAAACTATGGGTATTGACTGATGAGCCTCTGCACGGCCGCCATTGGCAT
GATAGGAATTCGGGATGGTTTGTAGTGTTTGCCGCATCTCCAGAGACGGT
GAGAGCATGTCAGGGATGGCACAAGAACCGCAGAGTGAGCTTATATTTCA
TGAGAAATTGGCCATGGCCAGAAATCTTTGCTGCGTACTGCTTGGAAGCT
GAGAACCCGCCCAGCCAAGACGAGATTAATAAACTCTTCACCACGTATAC
CTGCCTCGGCCCTGTCGCTCGTACATGCCTTGAATCGATTGATGTGAGCG
ACGATAACTTATATAACGAAACTCTCCAAAACTACCTTAGGGAGGTAGAT
CGTGAAATAGCGAAGTTCGTTGCCCGTGGTGGGCGCGAGACGGTTGAGCA
TGCTGTCCTTGTAGGCTCATCACACAAAATGGCTATTATGGATCCTACTG
AGGGTGGATTCTCCTATACAGCACGAATAATAACACGATGGATTGGCTAT
CGGGTGTATGAAAAAGCCCAGAAACACTCACAACATGGCTGTTTCGAGAC
GTTCAAGTGCCTTTCCCGTCACCCCGCCTTGAGAACTGCTGCAGGTTGGT
TCTTTGAAGGGTATGTGCATGACTGGC

Sequences in the Contig:

SY0AAA22YJ24FM1 SY0AAA41YM07FM1 SY0AAA43YK24FM1
SY0AAA45YL08FM1 SY0AAA49YB16FM1 SY0AAB32YK07FM1
SY0AAB36YE06FM1 SY0AAB46YD12FM1 SY0AAC1YF16FM1
SY0AAC58YJ01FM1