Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1251
Length(NT) : 771
Best Gene Model Blast : Link to GSTUMT00003467001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: argininosuccinate synthetase
Accession: ref|XP_001594845.1| Score: 863 E_value: 6e-91
KEGG Definition: hypothetical protein [EC:6.3.4.5]; K01940 argininosuccinate synthase
Accession: ani:AN1883.2 Score: 818 E_value: 5e-86
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1706 Score: 798 E_value: 6e-86
PFAM Definition: Arginosuc_synth, Arginosuccinate synthase. This family contains a PP-loop motif..
Pfam Number: pfam00764 Score: 686 E_value: 5e-73
Swissprot: P22768|ASSY_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0004055 = Molecular function: argininosuccinate synthase activity
GO:0006526 = Biological process: arginine biosynthetic process
GO:0000053 = Biological process: argininosuccinate metabolic process
GO:0000052 = Biological process: citrulline metabolic process

Sequence:
>Contig1251
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTTTCTTCTTACCCTTCA
CCTCCCCTTCCCTTCTTCCGTCTACTCGTAGCTTGTCTTTTGTCCTGCTT
CCTCCCCACTACACACACTCACACTCTCTTTAACATTCATCCATCTCTCG
CAAACAGTTTGACTTTAATTTCCCTCTGACTCCTCAATCAGTACTGCTAC
CATCATGGGCAAAGAAAAGGTTTGCCTTGCATACTCCGGTGGACTTGATA
CTTCTTGTATCCTAGCTTGGCTTATCGAAAAGGGTTATGAAGTTGTTTGT
TTCATGGCCGACATCGGTCAAGAAGAGGACTTCGAAGCCGCAAAGGAAAA
GGCTTTGAAAATTGGAGCCTCCTCTGTCCACGTTGTTGACCTTCGCAAAG
AATTTGTCGAGAAGCTCTGTTATCCTGCTATCCAATGTAACGCAATTTAC
GAGAACGTTTATCTTTTGGGAACTTCTCTTGCGAGACCCGTTATTGCTCG
TGGACAAATTGCTGTTGCTGAACAGGAAGGATGCACCCTCGTTTCTCATG
GATGTACCGGCAAAGGAAATGACCAAGTTCGTTTTGAGCTTGCATTTTAT
GCCTTGAAGCCGGACGTTAAAGTCATTGCACCATGGCGTCTTCCTGAGTT
TTACAACCGATTCGCTGGTCGCAACGACTTACTTGCCTATGCCGCAGAGG
TTGGCGTTCCCGTCTCTCAAACCAAAACCAAGCCCTGGTCTATGGACGAA
AACCTAGCTCATTGTTCGTAT

Sequences in the Contig:

SY0AAA33YB13FM1 SY0AAA45YK10FM1 SY0AAB33YL08FM1
SY0AAB43YI04FM1 SY0AAC43YE04FM1 SY0AAD39YB15FM1
SY0AAD41YJ08FM1 SY0AAD44YC24FM1 SY0AAD49YL15FM1