Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1250
Length(NT) : 2061
Best Gene Model Blast : Link to GSTUMT00011869001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein BC1G_03816
Accession: ref|XP_001557719.1| Score: 1186 E_value: 1e-128
KEGG Definition: aldehyde dehydrogenase
Accession: aor:AO090009000222 Score: 1153 E_value: 1e-124
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2456 Score: 1278 E_value: 1e-141
PFAM Definition: Aldedh, Aldehyde dehydrogenase family. This family of dehydrogenases act on aldehyde substrates. Members use NADP as a cofactor. The family includes the following members: The prototypical members are the aldehyde dehydrogenases EC:1.2.1.3. Succinate-semialdehyde dehydrogenase EC:1.2.1.16. Lactaldehyde dehydrogenase EC:1.2.1.22. Benzaldehyde dehydrogenase EC:1.2.1.28. Methylmalonate-semialdehyde dehydrogenase EC:1.2.1.27. Glyceraldehyde-3-phosphate dehydrogenase EC:1.2.1.9. Delta-1-pyrroline-5-carboxylate dehydrogenase EC: 1.5.1.12. Acetaldehyde dehydrogenase EC:1.2.1.10. Glutamate-5-semialdehyde dehydrogenase EC:1.2.1.41. This family also includes omega crystallin, an eye lens protein from squid and octopus that has little aldehyde dehydrogenase activity..
Pfam Number: pfam00171 Score: 708 E_value: 5e-75
Swissprot: P30838|AL3A1_HUMAN
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0008106 = Molecular function: alcohol dehydrogenase (NADP+) activity
GO:0004029 = Molecular function: aldehyde dehydrogenase (NAD) activity
GO:0006081 = Biological process: aldehyde metabolic process
GO:0006118 = Biological process: electron transport

Sequence:
>Contig1250
TGCTGGAAACAAGCAGGTACAGTACATGTTACCTTCTTCATCTGGCCCGC
CGATATAATGGTGATTAACCTTGACCCTGCTGCCTCGGCCCGGACAGCAA
TCGGGTGGAGGACCTCCAGACCCGAGCAACCACTACGATACTATGATATA
TCAATTCAGAGGGAGCACAAATTAGACCATTCCAAACTCAAAATCAACCT
TTTATTCAGCTCCGCAATACCTTTGATCAGGCTAGAATTAAAGGGCCTGC
TTCCGTCCTTCTCTTGATGCAATTCCTCCTACTTCCTCCAACTCTCCGTC
TGATAATCTTAAGGCTTCGTTGACCATTAGCGATCTCTCACAAACCGAAA
ACCACCATATAACTATCATACATACACGACCACCACCAACTCTCCGCTGT
GCCAGCAAGCAAACTCCGAACCCAATCTAAAGTCTGAAATGGCTTCCGAT
CTTTTAATCCCCTTCAGTTCGACTCCGGTGGAGTCCATCGCCCCGGCAGT
TTCACGTGTCCAAAACACTTTCACATCGCTCAAGACGCATCCTCTTGCCT
ATCGTGAGGAGCAGCTACGCAAACTCTACTGGGGTGTCAAAGACAATGAA
CAACGGCTCATCCAATCCCTTAATGCTGACCTCGGCAAGCCTTATTTTGA
GGCCGTGACAGTAGAAATAGATTGGATTGGTGCCGAGATCCTCTACGTGC
TCAAAAATCTCAGAAAATGGGCTGCAGATGACAAGGTGGATTTACCCTTT
CTGCACAGGCTTGTCTTGTCCCCGCGTATTCGGAAAGAGCCCATGGGAGC
GGTTTTGGTTATCGGAGCCTTCAACTACCCAGCTCAGTTGGTTTTGGTTC
CCCTCATAGGTGCGATTGCTGCTGGAAACACTGCCGTTATTAAACCATCA
GAGCAAGCTCCGAATTCGGCAGCCATCATCACTCAAATCGTAGAGAGCGC
TCTTGACCCCGAAGCCTATGCTGTCGTCAACGGTGGCATCCCCGAGTCGA
CCGAGCTTCTAAACCAAAAGTTTGATAAGATCTGCTACACAGGAAATGCC
GCGGTTGGTCGTATCATTGCTGCTGCTGCTGCAAAACACTTGACCCCGGT
GCTTCTAGAACTTGGAGGCCTGAATCCGTGCATTATCACCAAATCAGCAG
ATGCAAAGCTTGCTGCGAAAAGAATTGCCTGGGGGAAAGTTCACAACTTG
GGACAAGTTTGCCTTTGCCCCAACTATGTCATTATACACCCCTCTCTTGA
GGCCGAATTTGTCGGCGCATACATCCAGGCCCTGAAGGAATTCTTCCCTG
AGGGAGCATCCAAGTCACCAGATCTAGCACGCATCGTCAATAAAAGACAT
TTTCACCGCATCACGGAACTGTTGAATAATACCAAGGGAACGATCTTGTA
CGGTGGCGAGCAGGATGAATCGAGATTATTCATCGAACCAACTCTAGTCA
AAATCACCAGCCCGGAAGACAGCTTGTTGAGTGAGGAGATATTTGGGCCT
CTGCTTCCGATGCTCACTGTTGAAGATTTGGATAGCATGATATCAGTGGC
TAGAAAGGTTGGAGATTGCCCTTTGGCATTGTACATCTTCACCAGGGAAA
AGGAGGAGGAAGAGAAAATCCTGAAAAACATTAGGTCTGGTGGAGCGACT
GTGAATGACGTACTTTTCCATGCGGCAATTCCATCAGTTCCATTTGGGGG
GGTGGGAGAGTCCGGTACCGGGTCCTACAGAGGGAAAGCCTCTTTTGATG
CGTTCGTTCACAGACGACCCGTGGTGAATCAGCCGTTGTGGATGGAGGGT
CAACTTCGCGTATGTTTTACGCCCTGACCCGAGTAGTACCCTTTTATTTT
CCTTTTTCCTTTTCCCAACTTTTGAGCTCTTTTCTCCATGCACCCCAGCT
CCACCTTGCCAATGCACGATGAAAAAAGAGTACGACTGTCGGCCGCTCGG
CGCCTTGTCGGCAGTTTCAGGGCACGGACTTCGGTTCTAAGCGGACTTCA
TTCTATTTCTCCAGCCGCTTTTAGGATAGCTCTGTACGAGTACTCGAGTC
GGTGTTGCTAA

Sequences in the Contig:

SY0AAA27YG07FM1 SY0AAA45YK08FM1 SY0AAB54YG21FM1
SY0AAC10YN16FM1 SY0AAC14YC05FM1 SY0AAC51YP06FM1
SY0AAC62YL12FM1 SY0AAD23YD21FM1 SY0AAD29YM04FM1
SY0AAD33YG08FM1 SY0AAD45YH07FM1 SY0AAD46YD21FM1
SY0AAD50YJ23FM1