Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig125
Length(NT) : 2057
Best Gene Model Blast : Link to GSTUMT00011944001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein FG07121.1
Accession: ref|XP_387297.1| Score: 1360 E_value: 1e-148
KEGG Definition: hypothetical protein
Accession: fgr:FG07121.1 Score: 1360 E_value: 1e-148
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0615 Score: 901 E_value: 2e-97
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 709 E_value: 4e-75
Swissprot: P39009|DUN1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004672 = Molecular function: protein kinase activity
GO:0000077 = Biological process: DNA damage checkpoint
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig125
TTGGGGAAAGGAAAGAGAAAAAAAAAAAAAAAAAAAAAAGTCACTGCCGC
AGTGAGGCTGTAGCCTGTAGGTAGGTGATAAACGGCGGTGTCAGCCAACC
AAGGAAGAACCCACGCTGCCCCAATCCGCAACTCTAAACTCTAAACCTTA
CCCTCTCTTGGTTCTATCATACGGTACCTATCCTAACTATCCACCTCTCT
TCCCCCTCTACCCCTTCTTTCTTCCAAGACACAAACCTGCGAGCCCTCCG
ACATCATCGACATCTCCGTTGCCCTGCCTTCTTATTGCTAGGCAATCGCC
CACATCGCTGGAGGCTGATACCTTCCATCATCCCTTACGCTCCGGTACTT
AACGCGTCTCGGCGCTTCTGAGCAAACCCCAATTGACCTGTTCTCGCGAT
AATGACCCCTCGTGTTGAGGGAGCCGCCGTGCGCAAGCGCAGCCAGCCGT
CATCCCCGGCCTCTAATAAAAATTCACCCAAGAAAGTCAAGCGCCAGCCT
GATGATGATGTTGACCAAGTCGATGGGAGTGCTATAGTTGAGGATAGGGA
ATCTCTGGAATCTCTACTAAACCCGCAAGGTGACGTTACAATTACTCGTA
CTCCAGCATCCTCCCCTCCTCCTCAGGACACACAGGTAGCTTCGCAGTTT
TACTATCCACCGCTTTCTGAGCAAGGAGTCGACGAAGATGACGAAACCAT
CTGGGGATACCTTTGGCCGTTGACACAGAAAAATCAGAGTGTCATCAAGC
TCAACAAGACCCCCCAGGTTTCTACTCCAAATAAGGACTCTCCTAAAAGC
GCCGAGAAGAAGAAACCTAAGAATAATAATAAGAAACATGGCACTGGTGG
ATTCGTGATTGGGCGTCATGTCGAGTGTGACTTAGTCATTGACCATAACG
TTATCTCGAATAGACATTGTGTGATATATAAGGAGAATGCTGGTTCGCAC
CCTGTTGCGGTTCTCGAGGATTTATCTAGTAATGGTACCTGGGTCGCCGG
CGTTATAATTGGTCGCAACCGTAGTCGTACTCTAGAAAACGGTGATGAAA
TTGAGTTCCCAGGGGGATTTCAGTACACTTTCAGATACCCGCCGCACATG
CAATCCAGCGCTTTCCGCAATGCCTACGACCTTGGCCAGCAGCTTGGCTC
TGGTCATTTCGCTACCGTTCATCTCGCCGTTGATAAGAAATCGGGGCAGG
AGTTTGCTGTGAAGATCTTCAGAAAACGCCGTAATGAGGATAAGAGCAAG
ACTTCTGGGTTACAACAAGAGATCGCCGTCTTAATGTCTGTTAATCACCC
CAACATATTGTGCCTTCAGGGCACCTATGACGAAGATGACGGTGTCTATC
TTGTTCTAGAATTGGCTCGTGAGGGAGAATTATTCAACTACGTTATCCGC
AATACCAAGCTTTCGGAGGTGGATACTCGCAAAGTCTTTGTTCAGCTGTT
CAATGGCCTGAAATATCTGCATGAACGCAATATTGTTCATCGTGACATTA
AGCCGGAGAATATTTTGCTTTGTGACACCGATCTTACGGTTAAATTGGCG
GATTTTGGTCTTGCCAAGATCATAGGCGAAGATTCGTTCACTACCTCACT
CTGCGGAACACCTAGCTATGTGGCGCCGGAAATCTTAGAGCCCTCTCGTA
ACAGGAAGTACACCAGAGCTGTTGATATGTGGTCACTTGGTGTTGTCCTA
TACATTTGTCTATGCGGGTTTCCCCCGTTCAGTGACGAATTATACACACC
GGATAACCCGTATAACCTATCGCAACAGATCAGAGAAGCTAAATACGATT
TTCCGTCCCCTTACTGGGATGATATTGCGGACCCCGCACTTTACCTGATT
GAGTCCATGCTTGAAGTAAACCCGAACAAGCGGATCACTGTTGATATGGC
GTTGAAACATGCCTGGACTGTTGAAGGCACCTTTAATCCTGCGGAATCGT
GTGATTCTCTGGTTGGAGCTCTCGAGACGATGGGGCTTAGGAGGAGCGTC
GGTCGTGAGCGCACTCTGTTGGCGGAGCATCCGGAAATAAGACCGACTAG
GGCCGTT

Sequences in the Contig:

SY0AAA14YK08FM1 SY0AAA43YE11FM1 SY0AAA56YB13FM1
SY0AAA58YO04FM1 SY0AAA9YB16FM1 SY0AAB11YG09FM1
SY0AAB17YM20FM1 SY0AAB40YI05FM1 SY0AAD23YF10FM1