Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1249
Length(NT) : 711
Best Gene Model Blast : Link to GSTUMT00009008001 E-value : 1e-161
Numbers of ESTs : 9

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE58923.1| Score: 252 E_value: 4e-20
KEGG Definition: predicted protein
Accession: aor:AO090023000366 Score: 252 E_value: 2e-20
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0149 Score: 200 E_value: 1e-16
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 197 E_value: 3e-16
Swissprot: Q9SVM8|GRP2_ARATH

Sequence:
>Contig1249
TTGGACCCTTCTTCCATCTTGACACCCCAACCTTTCCTTCTCCCTCTCTT
CCCTCCCTTCTTCCCCTCTCCTTCCTTTCTTTACTCGCACTCCCATCCTC
CTCTTCAGAACGCTCCGTGAAGTTTTCTTCGCAGAGTACCCTCCCACAAC
AAACAAAACACAAGACCGGTATTTAGAAATATTCCTTTCCTCCCTCCTTG
CTCTATCTTTGCGTGCGTTTTTTAGAAATGGATTTTTCCCCATCTCCTGT
CCGGGGTAGCGCCCAAATTTTTAAGCCTCCCCTCCGTATTAAATCCTGCG
TCCAGTGCTCCATTTCTACTTTCCGCAAATAACAGTCAACACAATGGCCA
CCAAACTTTTTATCAGATCCCTCAGTTGGAACACTGACGATGTGAGCCTC
AGAAGAGGGTTCGAACAATTTGGAAACGTTACGGATGCCGTCGTCGTCAA
GGATCGCGAAACCGGTAGAAGCCGTGGATTCGGTTTCGTTACTTTTGATG
ACGAAACCTCCGCCAATGCTGCTATCGACGCAATGAACGATAACGAGTTC
GAGGGCCGTCGCATCGTTGTTGTCGTTGCCGAAGACCGTCGTGGTGGTGG
TGGTGGTGGCGGTGGATATCGCAATGACAGTGGCGGTGGATATCGCAACA
ATGGTGGCGGCGGAGGAGGTGCTTGGAGATAGGTTGAGGGCTGCTTGAGC
GTTGATCATGG

Sequences in the Contig:

SY0AAA19YE08FM1 SY0AAA26YA11FM1 SY0AAA28YL17FM1
SY0AAA37YJ21FM1 SY0AAA40YJ04FM1 SY0AAA44YE05FM1
SY0AAA45YK02FM1 SY0AAB38YL23FM1 SY0AAB45YM02FM1