Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1248
Length(NT) : 1020
Best Gene Model Blast : Link to GSTUMT00012129001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein An01g05920
Accession: ref|XP_001389016.1| Score: 800 E_value: 2e-83
KEGG Definition: hypothetical protein
Accession: ang:An01g05920 Score: 800 E_value: 1e-83
KOG Definition: No Hit Found
PFAM Definition: Methyltransf_11, Methyltransferase domain. Members of this family are SAM dependent methyltransferases..
Pfam Number: pfam08241 Score: 124 E_value: 1e-07

Sequence:
>Contig1248
TTGGCCACAACCACCCCAGCTTGACCACATTCACCAACCTCGAACTGAAA
TGGCAGAGACTCAACCTGATGCACCGCAAATCATCGAAGCTGACGATCCT
GGGTCGGGCAGTGACGATGAGTCGGCTTACGGATCTGGAGTGCCAAGCGA
CACCACTTCCCTTGCATCGGAGGTACGGGCATACGTATATGAGAATGGCC
GCCAATACCATGCATACAGCCAAGGTCACTATTGGGCTCCCAACGACGGG
AAACAAAATGAGCAATTAGATATCTTCCACCACGTTTATTCGCTCGTGCT
GGACGGAAATCTCCATCTCGCTCCTATAGGAGAACATCCTCAAAAAATCC
TGGATATCGGAACCGGAACTGGGATCTGGGCAATTGATATGGCAGACGCT
TATCCCAGCGCTCAAATAATCGGAAATGATTTATCTCCCATTCAACCGAG
CTGGGTCCCTGCAAATTGTCAGTTCGAAGTAGACGATTTCACAAAACCCT
GGACATACTCCCGCGATTCATTCGACTTTATCCACGCCCGTGGGATTTAT
GGCTCTGTGGGGTCATGGCCTATCCTTCTTCGCGAAGCATACTCCAGAAT
TAAGCCTGGTGGATGGTTCGAATCTGTGGAGACTACAGTTGGATACTATC
ATGACGATGGTCCCCGTGGCGAGGGACAATTAATTCCCAAAGATAACCCG
GTTTACAAATGGTGCCGGCTTGGCCTTGAGGCTGCGGAGAGGATTGGGAA
GCCGTTTGATGTTGCCGGGAAAGTTGATGGGTGGTTGGAGGATGTTGGCT
TCATAAATGTCACGCAGAAGGAGTATAAAGTTCCTACAGGGGCTTGGCCG
AGAGATGCACACATGAAGGATATCGGAAAGTACAATCTGCTGAATATGTT
GGAGGCAATTGAGGGGTTTACTATTGCGCTTTTCACTCGTGTTCTTGGGT
GGAGTCTGATGGAAACTCAGGTCATCCTCGCGCAGGTGAGGACTGAGCTC
ACCGACAAACGGAATCACTT

Sequences in the Contig:

SY0AAA10YM13FM1 SY0AAA10YP09FM1 SY0AAA14YO09FM1
SY0AAA1YD02FM1 SY0AAA42YG17FM1 SY0AAA44YE11FM1
SY0AAA45YH06FM1 SY0AAA45YJ24FM1 SY0AAA48YO23FM1
SY0AAA49YN10FM1 SY0AAA52YE08FM1 SY0AAA61YL12FM1
SY0AAA62YC18FM1 SY0AAB21YD10FM1 SY0AAB28YP06FM1
SY0AAB34YC10FM1 SY0AAB35YA17FM1 SY0AAB47YM08FM1