Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1247
Length(NT) : 860
Best Gene Model Blast : Link to GSTUMT00003358001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: translation initiation factor eIF2B epsilon subunit
Accession: ref|NP_594285.1| Score: 738 E_value: 2e-76
KEGG Definition: tif225; hypothetical protein; K03240 translation initiation factor eIF-2B epsilon subunit
Accession: spo:SPAC8C9.15c Score: 738 E_value: 1e-76
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1461 Score: 738 E_value: 7e-79
PFAM Definition: NTP_transferase, Nucleotidyl transferase. This family includes a wide range of enzymes which transfer nucleotides onto phosphosugars..
Pfam Number: pfam00483 Score: 116 E_value: 9e-07
Swissprot: P56287|EI2BE_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1247
TTGGACGACACCACCAACGCTCCCACTACCTTGACAGTTATCGCCGGAAA
AACTCAAGCTTTATGAGTAGCCGCAAAGATAAAAAGCCCCCCGGGGGGAA
GAAGCAAGCAGAGGAACAGCGAGAGAATATTCTGCAAGCTGTCGTGCTCG
CAGATTCCTTTCAAAAACGGTTTCGGCCGTTTACACTTGAGACTCCTAGG
TGCCTTCTCCCCTTAGCAAATACGCCTCTGATCGAGTATACCCTTGAGTT
TCTTGCTCTTTCCGGGGTCCAAGACGTTTTTATATTCGCCTCTAGCCATG
CCGAGAAGGTTGAGGAGTACATCCGTTCCTCGAGATGGGCAAAGAAATCG
TCACCCTTCAAGAATTGTCGAATCATTCTGTCACCGGCCAGTGCTTCAGT
CGGTGACGCCATGCGTGAGCTCGACTCCAAGCAGCTAATTACTACGGACT
TTTTGATGGTGCATGGGGATTTCATAAGTAACCTACCACTTGGGGATATC
CTAGATATTCATCGAAAGCGTAGAACTGCGGATAAGAACGCCATCATGAC
TATGGTTTTGAAGGAGGACAGCAGTGGGCTCCGGGCAAAGGCGAAGAGTG
AGAGAGGTGTATTTTTGGTTGATCCTGCTTCGAACCGGTGTGTCCACTAT
GACGAGATTGCCCCGCACGGAAGAGGTGGCGCGCTTGTACCCCGTGAATT
ATTCAAAGACCATTCCGAACTTCAGATAAGGAACGACCTGGTTGATTGCT
ATCTGGATATCTGCTCCCCCGACGTGCCTGCTCTATTCACCGAGAACTTC
GATTATCAACACATCCGTCTGCATTTCCTCCACGGCATTCTAACTGACTA
CGATCTCTAT

Sequences in the Contig:

SY0AAA45YJ05FM1 SY0AAD33YA06FM1 SY0AAD44YC11FM1