Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1246
Length(NT) : 1776
Best Gene Model Blast : Link to GSTUMT00006534001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein SNOG_09129
Accession: ref|XP_001799432.1| Score: 264 E_value: 6e-21
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07442 Score: 233 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1246
TTGGCGAGGAACGAGCGGAAGAGAGGAAAGAGAGGGTTGGTGGAAAGCTG
AGGTCACGTAGTCAGTCCTCTCTCTCTCTTTCTCTTCTTTCCTTCTTTCT
TTCATCGATTCCTTTCCCGTTTCATCCTTTCTATTGACCGGTTATTATAC
TTTTTTTCCCCTCCTTCCTCCCATACTACCGCACACTCATCCTATCTCCT
TCGGCTTGCTTAGTGGCTTGTTTACCTTTGCGCCGTCTTGGAAGCACGGA
GGATACGGTAGGGACGATTGATTGACCGAACTGATCCTTTCGTTTCCTTC
TGCTTGTTCAAGTCCAACGTCAGCACGGAAAGGGAAACAGGAGTTTCAGC
CTCACCTCAATCTCACCAAATACCACCACTGCAGCTTTCCAATTAATTTA
ACCCTACAATTCACTCAAACCCCGAGCCGAGATCGGAATAATAGAAAATA
AAAAAAGTCCTTTTCCATCCCGCCGAGTAACGGTATTACGACGAGCACCT
CAGTAGCAGCAGCAATAGCGGAGCCAAACGGTTGGGGACAAAATAACACT
CGGGCATCATGGTGAATGCGGCCATTCTCGTGAAGGCCAACTTGGCTCTA
CACATTATCCAGGCGTTATGGAGCGTGGTGGTAATGGGGGTGGTTATAGC
AAGCATGTCGGCGAAGGGTCCAGCGAGTGGTGCGATAAAATACATGTTTA
CAATGTGTTGGTTTGCGGTTCCGGCGCTGGTTTACCTGACCCAGGCGCCT
CGGTTTCCGAGGACAAAAATGTTTGCGCACCCGTACTGGGTTATTGGGGT
TAATACTATATTCTCGATTCTTTGGTTCGCGGCCTTTGTTTCTGTCGCTG
GCTACACTAACGGCGGGATCTCTGATGGAGAGGGGAAAGAGAAGGACGAA
AAGATCAAGAAGGAGGGTGGTTGTGCATTGTTTCCCGCTGGAACCGGCGA
GGACCCCAAAGCATGTAAGATGAACCAAGCAGCCGTCGGACTCGGTGTAA
TTCTGTGGTTTTTCTGGCTTGGAACTACTGGGATCGCGGGCTATGCCGCT
TGGTATTTCCGCCAACACAGCGTCTCCCCATTTGAAGATCTGAGCCCGGC
GGGGCATGACATTGAGGAAACCACCAAGGATGCCTTTAGTTCTAACGACG
AATATGCCCCCATTAACAGGGACCGGGATGAGGACGATGGTGACAGCAGA
TTCTCGCCATCCCATCATGAACGTAGCGGAAGTGTGACCAGCTACGATAC
CGGTTACGATGCTCACCCCGGCAACCCTGTTCCCTGGGGTGGCGAAGGAA
GCGCATATAACGGAATCGGAGGACATGGACCTGTGGCAATGGGTGGGAAC
AGAAGAACCCCCTCGGGATTGAGCATGCCTATCGCTCCGGATGAGGATTA
TAGCTACAGGGGAGCGACCACGAGATAGGATGTTATTCGTTTTCCTTTTT
TCTTCCGATATCCTTTTTTTTTCTCTTCCTGGCTAGGTTTTCCTTTTGAC
TCTGGTGCGGATGGGACGGGTTATCTCCTTTTGCGTTTTATATCCTTTTG
CGGCATGGAACAATGGAAAATGGCTTTTCAACTTGTATAACATTGAGTAC
GAATGGGGGATTTCTTGCATTGGGTTGGCGGCCGATCTGGACAGGGGATT
TGATCAAAGGAGGGAACTTGGATATGGCGGGGAGGAGGAGGGGGAAGTCG
TTGATATCATGTTTGGGTGTTTGAGATGGTGTTTTTTGATTAGGCCTTTA
TTAATGGAGCTATGAGTTTCTCTCGG

Sequences in the Contig:

SY0AAA18YJ10FM1 SY0AAA18YJ10RM1 SY0AAA23YL17FM1
SY0AAA31YM10FM1 SY0AAA45YI19FM1 SY0AAA57YK09FM1
SY0AAB34YE18FM1 SY0AAB35YE18FM1 SY0AAB47YJ04FM1
SY0AAC11YM17FM1 SY0AAC19YF17FM1 SY0AAC19YF17RM1
SY0AAC2YA20FM1 SY0AAC58YL06FM1 SY0AAC62YC09FM1
SY0AAD62YM05FM1