Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1245
Length(NT) : 930
Best Gene Model Blast : Link to GSTUMT00003592001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1245
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGCATAGCCGACACTTGTA
TATAATGAAACTTGGGTCCCACAGTGCCCATGCTCTACCTGGCTTGCGGT
ACTCCGCTCGTTATCTTGCATTGCTCATCAGGATTCACGACTCGGAAAGT
TCCTTTCCTCTTTACGATAACATAAATCACCTCGACCTCCCCCCTCCTCC
TCCTCTCTAGACCTCACCCAACTGAGCAGCCAACAGTACAACGCAAGGAT
GCACGAATTATCGAACTGGGGTCACGTGGTGCTAATATGGACACTTGTCC
TGGTACTCTACATTGTCCTCGGCCTGCGGACATGGGCGCTGCGAAACACG
AATTATAGCATGTTCTCACCGCGCGGAATCAGTACACTGTGTATCGCCCT
GACGGTAGCGTTAACAACCGCGGTTTGCGCGGTGGTTACATGGAGCTTGG
TCGGGCCGATGCACGGCGTTCCCAAGCGTGTTCTCACCTCACTTTACAAC
CCCGACTTGCCAGAGTCCGGAGACATCTTTTTTGGGCCGGATCCTCGAGC
CCCTTTGGAGACAGTTTTCAAGGTCAATTTTGGCTCCATGATTCTCTTCT
ACGTCGTCCTCTGGCTTATAAAAGTTTCTTTCGTCGTCATCTACTTTGAA
TTCTCCAAGGACCTATCCCGCCAAACTCGCACGCTCCTGTATATCACGAT
CGCAGCGGTTGCCGTGACCTTCGTGTTCGTGATCTGCCTCTATAGCCTCT
GGTGCCTCCCCGTGTCCGCAAACTGGGCCTTCAACGACCTCGTCCAGTCG
GGCACCTGCCGTGCGAGCCTGGCGCCGTCCGTCATCATCAGCGTCATAAA
CGTCCTCGTCGATATCCTCATCATGGTGGCCGGCTTCTCCATCGTGCGCT
CCCTCAATCTTGGTCGGAGCAACTTCCGCT

Sequences in the Contig:

SY0AAA30YD15FM1 SY0AAA32YM11FM1 SY0AAA45YH21FM1
SY0AAB21YP08FM1