Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1244
Length(NT) : 866
Best Gene Model Blast : Link to GSTUMT00007832001 E-value : 1e-110
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1244
TGTCAAAAAAGTTGGACGACCAAATGGTGAAACGACCAAATGGCGAAAGG
GTGAGCGGAAATGACGAAACGAAATTCCGATTAGTAACACAGCAGAAAAA
CTCTAAGTGCCAGGGCACCACTTGGGAACAAGACAGACAGTTTGCTCGTT
ATCGTCCAACTCTTTGGCTCTCTCTACTCTATCCCTCAACACAACTACCG
GTAACTAACTAAACTAAACGGTAAAGACAGGAGCAGGTATGGACCATGAT
AAAGGCATCCTCCTATCTTCTACTAATCACCAGACATATTCACGCTCGTC
CTTCCTTTCCTCCGCATACTCCCGCACTCGCGCAAAAGAAATACAGGCTT
CGTCAAGACCCCCCCACTATTCGCAGCTACCGCTCGGCACAGTTCCTTTG
GCTCTCCCGTACAACTTCCGATAGGAACATAATTTGCTTCTGGTGGATAT
ATGGTTTCCTTCCATAATGCGCTACCCCGAGGCACATCTCTGGAACCTCT
ATCCGAATAAGTGAAACGAGAACCTGAGCATCAGGGCGTGTCGAACAGCA
TCCGCGATTTCCGACAAAGATCCGTGTTTCCAGGGCGAGACGAGTGAAGA
AGGCGATACCACCCGATTTTCCAAAGGGGAGCAAAAATCACAAGGTCGAA
CTAGAAATGACGCTGTTTAAGAAAAGCAAACAGTGGGTGCGGGTTGGCAC
GGAAGCAAGGATATGGCTATATGCGAATAAGGGATAATATCGTAGCCGCG
AGGCAGGAGTGTTCGTGATAGTTGCGCAAGAGGTGATTGCGTTGATGGCA
CCATCGGTGTCTGTGCCCAGGGGTAGTGGGGTTATTGCCTCCCCGTTGGG
GTCAGCGATCTGTTGA

Sequences in the Contig:

SY0AAA27YE09FM1 SY0AAA45YH04FM1 SY0AAD40YK22FM1