Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1243
Length(NT) : 1078
Best Gene Model Blast : Link to GSTUMT00009930001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001271130.1| Score: 1031 E_value: 1e-110
KEGG Definition: hypothetical protein [EC:3.4.25.1]; K02730 20S proteasome subunit alpha 1
Accession: ani:AN4869.2 Score: 1027 E_value: 1e-110
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0182 Score: 956 E_value: 1e-104
PFAM Definition: Proteasome, Proteasome A-type and B-type..
Pfam Number: pfam00227 Score: 393 E_value: 8e-39
Swissprot: O94517|PSA6_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1243
TTGGGCGTGATTTATCGCCAATCCCCCGCCACTAGCAAACGATCCATCGG
ATTCTCATCCCCATCCCGAAATACTGTATCTTATCTTCGATAATAGGAGA
CCGTCAAGATGTCTGGGAGCGCCGGATTTGATCGACACATTACCATCTTC
TCGGATCAGGGGAGGTTATACCAAGTCGAATATGCGTTTAAGGCCATCAC
AGCAGCAAATATTACCTCCATCGGTATTAGAGGAAAAGATTGCGCGGTTG
TGATTTCTCAGAAGAAAGTTCCTGATAAACTTCTTGACCCTTCTTCTGTT
ACATACATTTTCCAGTTATCACCCTCTGTTGGCTGCGTTATGACTGGGTC
TATTGCCGATGCTCGTGCCGCAGTTTCTCGTGCTCGTGGGGAGGCGGCAG
AGTTTAGGTACAAATATGGTTATGAGATGCCTTGTGATGTGCTTTCAAAG
AGGTTGGCGAATATCAACCAAGTCTACACCCAACGTGCGTACATGCGTCC
GTTGGGTGTCTCCATGACCCTCATATCCGTCGACGATGAGATGGGTCCTC
AGCTCTACAAAACCGATCCGGCTGGCTACTATGTCGGTTATAAAGCTACT
TCTTCGGGACCCAAGCAACAGGAAGCCCTCAACCATCTCGAAAAGAAGCT
CAAGAATAAGGATTATGCTCCTGGTGATTGGAAGGAGGTCGTAGAAACAG
GAATCTCGGCTCTGAGTTCTGTTCTAAGTGTTGACTTCAAGAGTGGGGAG
GTCGAGGTCGGTGTCGTTGGTGCAGATGGGAAACCTGGGTTCAGAAAATT
GACTCAGGAGGAAATCGAAGAGAGGCTGCAGAGCATTGCAGACAAGGACT
AGGCGGAATATCCTGGACGGGGTTGATCCCTGTTACATTGAATAGAATGT
TAATGGCTCTCGCCATAATTAATGTGAATACGGAGCGATACCCTTTGTGC
TGTGAGTTTGGTGATATTGTTTTTAGTATGCTTCTCTAGCAAACGATTAT
AGGATGAGGGAGCTGTAGCTGGCGGAGACGTGAAAGGTGGATATCACAAA
AGATAATTATCGTGACTTTTCAATCACT

Sequences in the Contig:

SY0AAA26YH24RM1 SY0AAA3YJ18FM1 SY0AAA45YG06FM1
SY0AAC27YP09FM1 SY0AAD31YH06FM1 SY0AAD51YE21FM1