Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1242
Length(NT) : 498
Best Gene Model Blast : Link to GSTUMT00009783001 E-value : 8e-27
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1242
GCAAGAGTATATGATTCTTTCTCTTTCATCCATAATCCATTCAAACAGCG
ACGAGAATGATAAAATAAGTATAGGAAAAACGCACGCACGCACACACGCC
AGCACACGTGCGCGCCCCACACATACACACACGCACACGTACACATAGTC
ACGCGCCCGGACAGATACAGACTGACATATAGAGAATAGATAGAAAGAAC
TATAAGATAAAGTAGAATAATGGTAAGAAGAAAGAAGAAGAAACAGACAA
TGAAGTATCATCATAAAATGAATAGGTAGTCAGATAAACAACGGACGTAC
AGAAATATATCGGCAGAGGTGTGAATATAGGGTGATTGACGGATGGATGG
ATGGATGTGAACATATAATGATAGAACAGATAGAAGTGAAGAAGAGCGCA
AAAATAAAATAAAAGCATACAAACCCCCCCTTTTTTTCCCATCAGCCGAA
AACTACCACTACCAGTACTAACTACTACCCCGGCCGCCATTCCTTCTC

Sequences in the Contig:

SY0AAA45YF14FM1 SY0AAC25YF12FM1