Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1241
Length(NT) : 1425
Best Gene Model Blast : Link to GSTUMT00003192001 E-value : 0.0
Numbers of ESTs : 27

Blast Results:

Nr Definition: arginase
Accession: ref|XP_001588035.1| Score: 593 E_value: 3e-59
KEGG Definition: hypothetical protein ( arginase (EC 3.5.3.1), isoform 41K [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU02333.1 Score: 548 E_value: 3e-54
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2965 Score: 350 E_value: 1e-33
PFAM Definition: Arginase, Arginase family..
Pfam Number: pfam00491 Score: 387 E_value: 6e-38
Swissprot: P33280|ARGI_NEUCR

Sequence:
>Contig1241
TTGGCTGCCTCTAAGTGTTAGGCTTCCATCCTCGCACCGCTATCAAGGGC
TGCACCTGCCCCTAAGTGTTAGACTCGATACCGGTAACTCGATAAGACCG
AGCGGCGGGGAACGCTCCATACGGTTTACGTAAAGGATGGGGATGGGAAA
GGAGGAAGGAGATAAAGTAAAACAAGAATTCGAGGAGGGGGGAAAACATC
AGGGCCGTTGATAGCCTTTTGTATGTGAGTGCGTGTGTGTGTGGGCAAAA
TGGGTTGGCCAGTTGGCGATGATTTTCATGCTCCATGTGACCCGCACGCC
CGGGTTCTGCGCAAACTGGAGCGGAAGAATAGAGCTGGAAAGGTGGAAGG
GAAGGCTTGTCGCGCGGGAGGTTGTGTCATACTAAGTATCGTATGTATGA
TATATCCTGGTAGTTGGTTCCTGGTGGTGGCTGTGGTAGTGGTCTGGGCT
TCGGACAACACGGGGGGAAAACATGATTTAAGGAACCAAGCTCCTCTCCA
TTTCTTCCTTTCGCCATTTCTCCCTACTCTCTCTCTCTCTCTCTCTCTCC
CCTCTCCCCTCCTCCTATCTTCCCTTCAGCCTCATAGCTTGCGCCAACTT
GTCCACTTCTGTGCTTATGTTCCATAAGTTACCCTTCAATTAGTGATCGC
GTAAGTTAAGCTACCTTCCTTCCTTATATCCTACACTTTCCCTTGAGCCT
CCCTTCAATTCTTCCTAATCTTCCCGGTCCTCCCACAAACTTTCCTTTCC
TTACCTTCCTGCCCTTCTTCCAATCTTTGCACTCACCCCGCGGCCATCTT
TCTCATCCTTCGACTTTCAAAGAGCATCTCTCATTCGAACCGTCAAAATG
ACTGCTCCTTCAACTATTGCTACCAAGTTCCTTCCCGCAAAGGACCAGCT
TGGATTAGTTGCTGTTGGATTCTCGGGTGGCCAGTGCAAATCCGGTGTTG
ATGCCGCTCCTTCCGCTTTGATTGAGTCTGGGCTCTTGGCCGATATTCAA
GAGACCTTGGAATACACTCTTTATCACGATGGGGTTGTCCATGGTTATGC
GAAACACCTTCCCGTACCGGGAACCGACCTTCCGCTACGCACTGCTGGAG
CAAAGGCTCCCATGATCAATCCCATTGCTGTTTCCAGTGTTACGCATGCT
CTCTGCGACCAAGTTTACGAGCATGCTTCCAAAGGACGCCTTGTTCTCAC
CTTGGGAGGTGATCACTCTATTGCTATTGGTTCTGTTGCCGGCACTGCAA
AGGCAATCCGTGAACGTCACAATGGCTCTGAGATGGCCCTTGTCTGGGTT
GACGCCCATGCAGATATCAACACCCCTGAATCTTCTGGTTCTGGCAATAT
TCATGGCATGCCTGTTTCCTTTTTGACTGGGATTGCCAGACCACCCAAGG
AAAACCCTGATGTCTTTGGTTGGAT

Sequences in the Contig:

SY0AAA45YF05FM1 SY0AAA53YM05FM1 SY0AAB22YI07FM1
SY0AAB53YE19FM1 SY0AAC11YP20FM1 SY0AAC13YJ13FM1
SY0AAC16YM10FM1 SY0AAC17YB12FM1 SY0AAC17YD21FM1
SY0AAC1YF20FM1 SY0AAC25YL09FM1 SY0AAC44YB06FM1
SY0AAC49YK07FM1 SY0AAC4YI09FM1 SY0AAC52YF04FM1
SY0AAC52YN09FM1 SY0AAC52YP16FM1 SY0AAC5YH11FM1
SY0AAC60YK14FM1 SY0AAC7YD08FM1 SY0AAD32YL22FM1
SY0AAD40YM04FM1 SY0AAD41YH03FM1 SY0AAD44YM06FM1
SY0AAD52YA05FM1 SY0AAD61YD01FM1 SY0AAD61YP20FM1