Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1240
Length(NT) : 1285
Best Gene Model Blast : Link to GSTUMT00007653001 E-value : 1e-103
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_09256
Accession: ref|XP_001239635.1| Score: 223 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: ang:An01g02090 Score: 214 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1240
TTGGCCGACGTGGCAAGTCCCCAAATACCCCTAAATCACCTAAATCATCA
AGTGGGTTTTTGAGGAGGATGAGCTCATCTCTGTCTAAGAAGACCAAGGA
GCTGGCTGCTGAAGTTGTATCGACTGCGGCACCGACACCAGTGCCGGCCC
CAGTACCAGCACCTGGCCCCAGAACCAGCACTGATTCCCCAGCCAGCCCA
CAAGACCTATCTCTTGGCTGGTTGGATCAATGTTCAGTTACCTGATACGA
TGCTATGGAGACGACGATGTATGAAAATAGATTCGGATGGATGGCTATTC
CTCTCTCTGACGGATGACGAGAATTCCCCTCAGACAAGAAAATATCACAT
CCCCAGCGAGATCCGTACAGTCGACCTGCCGGACGTGGATGAGCAAGAGC
TCCCCCACAGTGTTAGACTTTTTCTAAAGGAAGGCGGAACACTCCAGTGC
GCTTGCCATAATCGTAGTGAGCAGAAGGAGGTTTTCGGAGTAATCCGTGG
CTGCACCTCTTAGAAACGATTTTTGTTTCTTGCCCCTCCTCCCACTATAG
GGCCCCGGCTCACACGTGGCCCTTGGTAATTATTTTACATAACCTAGTTC
TCCAGATACCACTTTTTTTCAATTGTTTGTAAACAACTGGTCGGATGCCA
CAACGCCCTGTGGACGTTCTATCATGCACCCGTGTTCTTTTTGTCTCAGG
GCTAGTCACCACATCGAAACTCTTTTCCTATTCCTTACTATCGTCCTATA
TTCTCTTTCCATAATATTATTATCTTCATAGCGAGGCGGGTGTGGGGGTA
AGCAGGGGTTTTTGTCTGTGATTTCCAACATTTACTTTTACTCTTTCTAA
ATTTTTTATTGAGCATCTCCCTAAGGAGTGACTTTTTCTTTGGGCGTAGC
CTTTTTTATGTTCTTCCCTCCCCGCATTCCCTTTGACCTGTGTGTGCGAT
ATTACCTAGCGCAGTGCCAATTTTCTTGCTCTCTTTTTATTTATTTTATT
TATTATATACCCCTATTTTTACATTCGTATCACCAAACTGGATGGATAGA
GGGGGAACGGGAACGAGAAGGACAGTGGGGATGTTCTATCCTGTGTATTA
TTATGGATTACACTTTGATTGGTTTGGTCGGTCTAGTTGGGCTACGATAT
TTCAGCGGTACTGTGCACGGGTACCGAGTTGTCCGTCCGGCGGCGTACTG
AGTACTTACATTCTACGTTCTACCACACACACTTTTTTTCTTTTGGTTTT
ATCCTTATTATCATTTAATTTTTCCTGTTTTATTT

Sequences in the Contig:

SY0AAA45YF02FM1 SY0AAB1YO20FM1 SY0AAD25YH04FM1