Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig124
Length(NT) : 1180
Best Gene Model Blast : Link to GSTUMT00005064001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_01537
Accession: ref|XP_001597343.1| Score: 273 E_value: 3e-22
KEGG Definition: hypothetical protein [EC:3.1.1.47]; K01062 1-alkyl-2-acetylglycerophosphocholine esterase
Accession: mgr:MGG_04084 Score: 266 E_value: 1e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig124
TTGGGGAAAAGTCCCCGAGGACGCGATTATGTCTAGTGATGAAGGAGAAA
TCAATGAAGGAACAATGAGTCCTGAGGCAAAAAATCTATTATCAACCTTC
AAAGGAAATTTGGATGTTAAAGACCCGGGAAAGCTGATCTGGGCTGGTCA
CTCCTTCGGTGCTGCGACCATGATCCAATTTCTCAAAAGCGTCTATTACC
CACCTCCGACGAAACCGTCAATAAACCCCCTCTTGGCCCTAGATGCTTCT
CTCCCCCCAAATTCCTTCGATGTTCTGCCGCTTGGCAAGCAGATAACAGC
CACATCGCCTCTCCTCCTCCTGGATCTGTGGTGCCTTCCGCTGCTGGGCA
AGCGAACAAGCCACCTATTCAAACAGCCCCTCCCACAAATATCAAATAAA
CCAAACCTTGTCTTAGTAATAATGTCCGAGGAGTTCTTTCGCTGGAAAGA
AAACCTCCGTGGTGTGAAGCGCATCCTCTCCCCAGAGCCGGGCCAGAAGA
GAGGTACGCCCCACCACGAAATCTTCGAAAAGTGGGACGAGGAAGATACT
GGAGATGCTAGAGACACCGCCGCTCACGAAGATATGTCAAAACACTTCCA
TCCAAATAACGACCTCCTCTCACCATCAATATCACCGGCCGTTGGATTAT
CCTCTACTCCCGACCAAGGCGGCCAAATTATACCGCCAACAGCCACTCCT
TCACCCACTCCGGAAAGGCAGCACAAGCACCAACATCACGTAGTTAAAAA
TAGAGAACCACGCTTTTACTACGTCAGGAAATCCGCACACCTATCGCAGA
GCGACTTTGGAATACTTTTCCCGGTAGTCGCGCGTCATGCGGAGAACCCG
CGAAGGATATTGGACCTAAACGTCCGCGCTACGATTCAGTGGCTCCGCGA
GGCTGGGTATAGCGATAGACTCGCGAAGACAGAACACTTGGAAGAGCTAG
TCCATGGCTTACACCTCAACGGTGACGACATGGACAAGGGCGAGGAATCG
AAGAACAGGGAAGGCGATTGGGGAATATGGGAAGAGGGGGGCACGGGTGC
GGAAGGGTGGGGAAGGATTGATCTCGAAGAGACGGACATTCCTGAGGTCA
AAATTTAGTCAAGTGAAAAACGAAAAGCAATAAGACATATGGTAATTGGC
TGGAGGTACATATAAGATTAAATTTCCATG

Sequences in the Contig:

SY0AAA14YJ21FM1 SY0AAC26YL04FM1 SY0AAC7YL16FM1