Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1239
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00006787001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_01147
Accession: ref|XP_001247376.1| Score: 369 E_value: 8e-34
KEGG Definition: checkpoint protein kinase (SldA), putative [EC:2.7.11.1]; K02178 checkpoint serine/threonine-protein kinase
Accession: afm:AFUA_6G08120 Score: 363 E_value: 2e-33
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG1166 Score: 289 E_value: 5e-27
PFAM Definition: Mad3_BUB1_I, Mad3/BUB1 homology region 1. Proteins containing this domain are checkpoint proteins involved in cell division. This region has been shown to be essential for the binding of the binding of BUB1 and MAD3 to CDC20p..
Pfam Number: pfam08311 Score: 409 E_value: 5e-41
Swissprot: O59767|MAD3_SCHPO
Gene Ontology:
GO:0000778 = Cellular component: condensed nuclear chromosome kinetochore
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0007094 = Biological process: mitotic cell cycle spindle assembly checkpoint
GO:0051444 = Biological process: negative regulation of ubiquitin-protein ligase activity

Sequence:
>Contig1239
TTGGCAACAACCACATTTCTGTATCTGCTCCTCGTTCAACCTATCAATCG
TGCTCATCATGGCTGACGATGATACTACCTCCTTCGACCAGATCGAGCTT
CACAAAGAAAACATTCAGCCCCTTGCTTCCGGACGCTCAGCTCGAGCCCT
TGTCGCTTCTCTCTCGTCCCGTTCGAACCCAGTATTTGCCCGTGCCGAGC
ATGCAGTTAAACAAGCAGAGTTTGAGGAGGAGTTACGAGGATCTTTAGAC
TTGGATGACCCTTTAGAAGTCTGGGTTCGTTATGTCAACTGGACACAAGA
GACCTTTCCGTCTGGTCATTCGACAGACTCTGGTTTACTACAGCTGCTGG
AAAGGGCAACACAGACATTCATCCACGAATTACACTACAAGAATGATCCA
AGATACCTACGCCTATGGATTCAGTATATCCAAAACTTTTCCGATGCTCC
CCGGGAGGCCTTTGCCTACCTTGCTAGACACGACATCGGTCAGCGGCTCG
CCTTGTTCTACGAAGAGTACGCTGCTTTGCTTGAAAAAATGGGTAGAAAG
AGACAGGCTGGCGAGATTTACCAGACTGGGATGGAAAACAATGCTAGACC
TACGGACAGACTTC

Sequences in the Contig:

SY0AAA45YE23FM1 SY0AAC35YF17FM1