Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1238
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00011556001 E-value : 1e-168
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_06785
Accession: ref|XP_001592544.1| Score: 281 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: ang:An08g03940 Score: 278 E_value: 2e-23
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1784 Score: 267 E_value: 2e-24
PFAM Definition: LSM, LSM domain. The LSM domain contains Sm proteins as well as other related LSM (Like Sm) proteins. The U1, U2, U4/U6, and U5 small nuclear ribonucleoprotein particles (snRNPs) involved in pre-mRNA splicing contain seven Sm proteins (B/B', D1, D2, D3, E, F and G) in common, which assemble around the Sm site present in four of the major spliceosomal small nuclear RNAs. The U6 snRNP binds to the LSM (Like Sm) proteins. Sm proteins are also found in archaebacteria, which do not have any splicing apparatus suggesting a more general role for Sm proteins. All Sm proteins contain a common sequence motif in two segments, Sm1 and Sm2, separated by a short variable linker. This family also includes the bacterial Hfq (host factor Q) proteins. Hfq are also RNA-binding proteins, that form hexameric rings..
Pfam Number: pfam01423 Score: 146 E_value: 2e-10
Swissprot: Q5RCP3|LSM8_PONPY

Sequence:
>Contig1238
TTGGCTCAATCCGTCCGCACCTCGAGGACAAATTCCTCATTCCACCCCAG
TCATGGTCTAACCTTCAGACCTTCGTCAACAAAACCGTCACAATCATAAC
TTCGGACGGAAGAACCCTTACCGGCAAGCTTATGGGTCACGACCAAACTA
CCAACCTCATCCTTTCTCGCACCATCGAACGTATCTTTGCAACACCCGGG
TCCGAGGAGGCCACGCAACAAGTTGAACACGGATTGTATTTGATTCGTGG
GGATAACGTTGCCATTTGCGGGCTTGTGGACGAGCAGTTGGAGGCTGGGA
TTGATTGGTCGGCAGTGAGGGCGGAGCCGTTGGGTGGGATGAAGCATGTA
TGAGTTGGTGGGAGATATCGTGAATGCATTCAGGGCATGATGGAATAGGT
GGGAACAGGAGGATCAGGATAACGTGTTTAGTTGCGAGATGGGTTACGGA
TACGAGTGCTGATTTATGTGGCGTGTCGAGGCATTGGGTTTTCGAGTGTT
TGCTACCGAGCAAATTATCCACCCCTCCATCTGTAAGCCGGTCACGAACG
CAGGGGCTATCAACTACTTCGGACTTGCTGGGCCTTTCTTCCTGTTTTCA
GTTCTTTTTGTTCGAGTTTACCACTGTGGGGCCATGTGTCTAGCTCCTCT
TTCCTCTATGATAGCAGTATCGAGAGGGTA

Sequences in the Contig:

SY0AAA45YE11FM1 SY0AAA46YA18FM1 SY0AAB20YB11FM1
SY0AAD8YH16FM1