Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1237
Length(NT) : 1403
Best Gene Model Blast : Link to GSTUMT00011271001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein AN3795.2
Accession: ref|XP_661399.1| Score: 1135 E_value: 1e-122
KEGG Definition: hypothetical protein
Accession: ani:AN3795.2 Score: 1135 E_value: 1e-122
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0653 Score: 413 E_value: 6e-41
PFAM Definition: Cyclin_N, Cyclin, N-terminal domain. Cyclins regulate cyclin dependent kinases (CDKs). Human UDG2 is a Uracil-DNA glycosylase that is related to other cyclins. Cyclins contain two domains of similar all-alpha fold, of which this family corresponds with the N-terminal domain..
Pfam Number: pfam00134 Score: 353 E_value: 4e-34
Swissprot: P24866|CG11_CANAL

Sequence:
>Contig1237
TTGGCTTTAATACTATTTCTACCCACCGTGGTTTAGTCTTGGTTAGAAAG
GACAGACTTCCTTCCCTCAATCATTCTGTCTCTCTCTAATTCGCCAGTCT
GCTATTTCTTCTTCTTAATTTTTTGTCGTTCTTTCGAAATACTTCCGATC
ACCTTCTTTTATAGTTTTTTTTTTTTTTTTTTGCAAAAGACGTTTTCAGT
CCTTGCAATAGCCCTTCATTACGGAAGAATCGAACCCTCGACGTCCACTC
ACTACTTTAATACTTAAAACTATACCCCCCTCACCACAACCATGGCCTAC
CAACCTTGTGATTCTTATTTCGTGGAAGATATGGAGCAGGATGGCGTTTT
TGCGGCTAGCAGGTCAAGACAGGAGAAGGCTCGCATAGATGCGGATACAC
AGATGGAGATTGCTGATGAGATGTCGCTCATGGTTTCCGAGGAGTATCAA
GAAGATGTTCTCGACCATATGGAAGTTATGGAGGCCGAGACTTTACCGGA
TGTGGCTAGTATCGATATCCAAACGGAAATCCAGTGGTTCATGCGTCCGT
ATCTTCTCGATTTTCTCATTGAAGCCCATACAGCTTTCTCACTTCTCCCG
GAAACCCTGTTCCTTACTGTTAATCTTCTCGACCGATACTGTTCAAAGCG
TGTCGTCTACAAGCGTCACTACCAATTGGTTGGATGCTCGGCCATGCTTA
TTGCTGCTAAATATGGAGATAGGAAGGATAGAGTGCCAACAATACGGGAG
TTGAAGTCTATGTGTTGCGGCCTTTATGATCAGGACATGTTTATTCAGAT
GGAGTGGCACGTGCTCCAAACTTTGAACTGGACTGTTGGACATCCTACGG
TCGACAACTTCTTGCAAATGGTTCTTCAGGAGGTGAACTGCGACCTTGAG
GTGGAATGTATGGCGAGGTATCTTTCAGAGGTTGCACTCTTTCACAAGGA
TTTTGTTAGCGTACGGCCATCTGTTATGGCAAGGTCTTCATTGGCTCTTG
CTCGTCACATCCTTGGCCGCCCCATCCCCCGTCATTCGGAATGGGCTGGG
AAATACGATACGAATGTTCTTGTCCTTTTGTCTCAGAACCTACATCGCCC
TTCGTCGATTCTATCACGAAAATACGCCAGCCCGGAATACGCGTGTGTTT
CGACAATCTTAGAAGAGTTTTTAGCTCGTCAGGCACAGATTGCCAAACAG
CGCATGCCCCCTACACCGCCGTCAGAAGTGTATGAATCCTCGCGGACAGC
TATGGATGAAGATATGAAGTCTCAGGATGTACATATGACCCCTTCAAAGG
GTCAGCAGCAGGTTACTATGGGATACATTACACCACCAGTAACACCTAAT
GCAGGATACTTTGCTTCGGATGGTGGTGTTCCTTCGTCACGGATGCCCAT
AAC

Sequences in the Contig:

SY0AAA10YN21FM1 SY0AAA1YC16FM1 SY0AAA23YF11FM1
SY0AAA34YN08FM1 SY0AAA45YE03FM1 SY0AAB13YL18FM1