Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1236
Length(NT) : 734
Best Gene Model Blast : Link to GSTUMT00003983001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215767.1| Score: 235 E_value: 4e-18
KEGG Definition: hypothetical protein
Accession: ang:An07g04660 Score: 207 E_value: 3e-15
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1984 Score: 190 E_value: 2e-15
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 166 E_value: 1e-12

Sequence:
>Contig1236
TTGGCCGAGTCCCACATTGGCCCAATGTCACATCAGTTAGTAGGAGGGTA
TAAGGAGGAGCCGGCCACTGAACCGGATACCCACCCAGGTCACCCTCAGC
AGCACCCACCGCCACCGTCATCTGCGTCAACCCAGCATCCCCAACAACAA
CAGCAGCAGCAGCAGAGCCAGCATCCCCGACCTAGCCTACCTCATCAACA
CTCAGGGCAACCCACTCCTTCGTCAACTACCTTCCCGTCACCACATCCTC
CTCCACATCAATCATCTTTTGCTCAGTCACCTAGTCTGCCCGGATCTCAG
CATTCTCATCCGCAAGACATCGCCTATTATACCCATCCCTCCTCCCCCTA
CGGCACCCCAGGCGGTAGTGGCCCTTCTTACCCATCTCAAGATCTTATGG
CAACGCACACAATGAATCGTCCGCAATACCCCCCTATTTACCATACTCCT
CAGTCCAATTCACCCTCATCTGTCGCGTCTCCCACCGCCCCAGATCACCG
GTCTGTTTACACTACACAGCCCATGCAAACCCCGATGTACGGCTATCCGC
AACAGTACCCCCCGATTCCAGCAGGTCCTTCCTCGTACTCAAACCAAACT
CAACATCATAATTTGAACAATGGGCCACTCCTCATGTCACAGACTTCAGG
GCAAACCATGACTCCACCGCAGCCTCACCACCAGCATGTGGCTCCAAACA
CTTCATCGACTGCAAAGATTGCCCAAACACCACT

Sequences in the Contig:

SY0AAA21YJ07FM1 SY0AAA45YD04FM1 SY0AAA7YL23FM1
SY0AAB15YO05FM1