Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1235
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00001197001 E-value : 1e-162
Numbers of ESTs : 2

Blast Results:

Nr Definition: nucleosome binding protein
Accession: ref|XP_001542972.1| Score: 334 E_value: 1e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU09995.1 Score: 327 E_value: 4e-29
KOG Definition:
Classification: [Transcription, Replication, recombination and repair, Chromatin structure and dynamics].
Kog Number: KOG0526 Score: 267 E_value: 2e-24
PFAM Definition: HMG_box, HMG (high mobility group) box..
Pfam Number: pfam00505 Score: 222 E_value: 3e-19
Swissprot: Q7S045|NHP6_NEUCR

Sequence:
>Contig1235
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTCCCTTTTCGCTGCTTCCT
GCGATAAGATAAAAAATCTCGAGTGACCCGAACAACCTAACTGACCATCA
ATTTCGAAAAACACAGAACTCTTTCATCTTTGCTAATCCCCTAAAGTCTT
CTTGTTGCAATCGCTTCTAAAGTACCCCTGTTGTCACATCTTTAGTATCA
TAATGCCTAAAACTGAGCGTATTCGCAAGCCTGCCAAAGCTGCCAAGAAG
AAGAAGGATCCTAATGCCCCTAAACGTGGTCTCTCTGCCTATATGTTCTT
CGCGAACGAACAGCGTGAAAATGTTAGGAATGACAATCCTGGAATTGCAT
TTGGTCAGGTTGGCAAAGTCCTAGGTGAACGCTGGAAGGCTTTGTCCGAA
AAACAGCGCCAGCCCTACGAAGCCAAAGCGGCCGCGGACAAGAAACGATA
TGAAGATGAAAAGGCAGCCTACAACGCACAGGGAGGCCCCGAGGAGGAGG
AGGACGACGAATAGTGACTTGGTTCTTTATTTTAGTTCTCTTGACATCCG
TTCACCCGTTTTCAGTTCATGGAATAACCGTGCTTCTCTTTGCCTACACA
ATACCAAAAGCAAAAAAACAAAACTCAACCGTCCCGATCCCTTTCTTGAG
ATGATATCCCAATATCAACATTTGTTGTGGCCGTAGAAGTGGGGTTTT

Sequences in the Contig:

SY0AAA31YP03FM1 SY0AAA45YC21FM1