Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1234
Length(NT) : 535
Best Gene Model Blast : Link to GSTUMT00002755001 E-value : 1e-132
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_09779
Accession: ref|XP_001227706.1| Score: 141 E_value: 2e-10
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 127 E_value: 3e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1234
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTT
TTTGTACAAAGTTGTCCCCCGTTGAACACAACAGTGAACGTGTCGAACTA
TGGAATTTCAGATGAGCGGTCTCAGATCTTGACCTGGCTATCGCCGCTAG
AGCCCAGGCTACGGCATCAGGATATTCGCGAACGCCGAGTTGAAAATATA
AGGGAATGGATCTTACAAACCGAGGAATTTAGAAGCTGGTACGCCGGCAG
TGGGGGAAGCGAAGCCGGCAATGCAGTTCTGTTTTGCTATGGAGACCCGG
GTGTGGGTAAGACATATATTAGGTAATGGGAAGTATTGAGAAATGGGGGA
AAAGGCGAGTGCTGACAAGCTGCGATGCTAGCTCATTAGTGATAGACTGG
TTGTGTGACCAAGCGAGAGGACAAAACTCCAGTGTGGCATGTTTTTATTT
TGACTTCGCCGTGCAAAATGAGCAATACTCCATGAGCATGCTGCGTGCCC
TGGTGAAACAGCTTGTTGGTGGACTGGACGAGACC

Sequences in the Contig:

SY0AAA38YI19FM1 SY0AAA45YC07FM1