Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1233
Length(NT) : 2286
Best Gene Model Blast : Link to GSTUMT00004793001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein SS1G_00350
Accession: ref|XP_001598264.1| Score: 535 E_value: 3e-52
KEGG Definition: hypothetical protein
Accession: ani:AN0462.2 Score: 532 E_value: 4e-52
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 156 E_value: 6e-11
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 120 E_value: 8e-07
Swissprot: P33332|SEC3_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005934 = Cellular component: cellular bud tip
GO:0000145 = Cellular component: exocyst
GO:0000131 = Cellular component: incipient cellular bud site
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0006904 = Biological process: vesicle docking during exocytosis
GO:0006906 = Biological process: vesicle fusion

Sequence:
>Contig1233
TTGGGCATACGGCTCCACACACAGAGTCTCCGAGATCTGCCCCTACTTGG
AGACAGCTCCCCTTTCTTCTTCCAATACGAGTACTCGAGCAATACCCTCT
CTGCCCTACCCACGCATCAACACGCCGTCCTCGTCGCCACCATGGCAGAC
CAATTTCAAGCGAACCGAGCCCCGGGCCCTGGCGCAGCTGGACCTCCTCC
CACAGCTGCCGGTGCTAAAGCTCGACAATTTGAAGATGAGAAGAGGCGGA
TCACTGCTTCGTGCTTTTCAAAACCTGATGTCGATGGTGCTCTCCTAGAA
TCTTACATCACGCATTGCAGAGTTATCGAGGATGGAGCCTCCCCATCGTC
CCCACCGCTAGCAGATGGCCCTCGCGATCAGAAAAAGTCCAGGGTGATTG
TCGTTGCCGTGCGGAAGACTGGGCGAGTTCGCATGCACAAAGCTCGTGAG
AATCCGAACGGTGGCTTCCAGATTGGAAAGACATGGAATTTGGATGACTT
GTCTGAGATAGAGAATCACATCGCACCGTTCGAGAAGGGATTCACTGTCA
CTATTATTAAACCTTACTATTGGCAAGCCAATTCGAGTAAAGAGAAGGAT
TTTTTTATCTCGTCGCTGCTTAAAATTTACAAAAAGTACACGGGCGGGAA
AATTCCAACTTTGATCGGTTTTGGAGGGACAGAGGTCGATAAGATGTTGG
GTGGTGCGGCTTCTCTGCAGGAAAGTCAGAGGGATGATACAGGGGGAGCT
TCGCCAGCTGGTCCCTCGCCTGTGTCTCCGGGTCCCTCACAGTTTTCTTC
GTCACTCAAACCGACACCCCTTCGCAATCTCACCTCAGCTGTCTCTATGG
ATAATATGGCATCACCAGGAAGACAACCATCGCCAAGGAATAAGGGGATT
GACGGACTTCGCACTGGCCCCGGCCCTTTACGACCATCGCAGTCAAGTGA
TCCCCTTCCAAGTAGTAGTAGAAGACCGCCCGATTTGCCCCCCGGGAGTC
GGAATATATCTGGAGCTTCAGCGTACTCGACCGCTTCAGGAGCAGCTCTC
GGCGATCCTTCACCTCCCCCTATACCTCCACAAGGACCAGGAAGGCGGCC
ATCGGATGGATCTTCGAGGTCTGGTAGGGATCGGTCTGGGACCAGGGGAG
CTCCTGTAGAGGACGAACGAGGAATTCGTCGTATGCCATCGTCTGAGAGA
ATGTTCCGTACCCCTTCCGCTTCTAGTCACCAATCGCGAGAGGCTATAGA
CCAGTATCCCTACGGCGGTGGTAATAGAGGACCACCTCCTCCAGCAGCTC
CCCCCGAGCCTTCTCTACTGATTGACGCACGTGGTGTAGCCAAGAAAATG
TCCAGCAAAGACGTAGCGTCGCAATTCCGCTTGGCAGCAAATACATACGC
TGCAGGAGGAATGATGGGAGACCGAAGGCAGCGACCAAAAACTCCTACAA
CACCGACCACCATGTCCAGAACACCCTCTCAGGATCCGGGTAGACAGGAG
GAGGTGCCAAAGATCAAATATCCAGAAGAGCGCAAGGATCGGGACGCACG
TGGTGGGAATGGGTCATATGGTACCGCAGGTGCGCCGGGTGAACGTAGAC
GTTCACCTTCCAGAACTCGTGATCTCCCGCCACCATCATCCAACCAGAGG
TCTCAAGAAAAACAAATGGAGCCACCGCTAAGAAGCGAAGTTCGGAGAGC
TACTCTTACACCTAAAGACAAACCTCCGGTATTGTCTTCCCCTACACCGC
GAAACGCGTCCCCTGGCCGGCCAAAGCATGATTCATTGGAAATTCCTACG
GCCTCGGGGAGGTCCACATCGCCAGATGGACCAGGTGATGTTGGCGAACG
GGGTGAGAGAAGTAGATCGCGATCACCAAATACTAAGGGTAGGAAGCGTA
AATCGGTCAAATCCTCTTATCTAAATGATGTAGATACTTCGCGGGTGACT
GTTGATATTGAAGACCTGTTAAGAGAATTCAATTGGGATCCACAAGGGAA
GGTCGATGCTCTGGAGACAAAGATTCGCAAAGATATTGCGGAGGTGGAGG
CTAAGGATGTTATCGTGAATACTGATGGCGATTCCAGGATTGAGGAGTTA
TCCAGCCTCCTTGATAAGGCGATTCAGGAATGTGATGAGATGGATTCACT
GTTGACTCTATATGCCGTTGAACTAACCAGCTTGAATGATGACATCTCTC
ACATCGAAAACCAGTCCCAAGGCCTCCAAGTCCAAACTGCTAACCAGAAG
ACCTTGCAGCGTGAGCTGCAGAATCTCATGTCTATC

Sequences in the Contig:

SY0AAA45YC02FM1 SY0AAA5YD22FM1 SY0AAB19YO07FM1
SY0AAC20YH18FM1 SY0AAC29YF07FM1 SY0AAC2YE15FM1
SY0AAC31YB10FM1 SY0AAC31YD10FM1 SY0AAC39YO16FM1
SY0AAC51YL06FM1 SY0AAC55YM14FM3 SY0AAD20YI17FM1
SY0AAD24YF11FM1 SY0AAD26YK14FM1