Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1232
Length(NT) : 839
Best Gene Model Blast : Link to GSTUMT00006911001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: laccase-like multicopper oxidase
Accession: emb|CAK30044.1| Score: 783 E_value: 1e-81
KEGG Definition: hypothetical protein
Accession: ang:An05g02340 Score: 608 E_value: 1e-61
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1263 Score: 293 E_value: 2e-27
PFAM Definition: Cu-oxidase, Multicopper oxidase. Many of the proteins in this family contain multiple similar copies of this plastocyanin-like domain..
Pfam Number: pfam00394 Score: 282 E_value: 5e-26
Swissprot: Q12570|LAC1_BOTFU
Gene Ontology:
GO:0008471 = Molecular function: laccase activity

Sequence:
>Contig1232
TTGGCCTACACCTGGCGTGCAACTCAATACGGAACATCATGGTATCACTC
CCATTATGCTGTCCAATACGCCGAGGGCCTTCTAGGCCCGATAATCATCA
ATGGGCCAGCCAGCGCAAACTATGATGTAGATTTGGGCGCCGTAATGGTC
AACGATTGGTATCATAATACCGCGTTCTCCACCTGGCATTATGCCGAAAC
GGTGGGACTCCCGCAGGCGCAGAATGGGTTGATTCACGGCCAGAACGTTT
TCGGATCCGGTGGATCCCGTTGGACCACCACCTTCATCCCCGGGAAGAAG
TACCGCTTGAGGTTCATTAACACCGGCGTTGAAGCCGCATTCCGTATATC
AATCGACGATCATAAGCTCAAGGTTATTGCCGCCGACTTCGTCCCCATCA
CCCCTTATACCACTGATTCCATCCTGATCGGCGACGGGGAGCGATACGAT
GTCATCGTTGAGGCAAAGTCTCACTTTACTTCTAACTCCACCTTTGCCTC
TAACTCCACCGGTGCTGCCGACTCGAAAAGCTTCTGGCTCCGCGCAACCG
TGCAGACGGCCTGCAGCACAGGCGTCGACAACCCCCTCAACATCAAGGGC
ATAATCCGGTATGCGGGGGGTGCGACCAGCGGCGACCCAACAACTACTGG
CGTGACGATCCCGCAGAACTGCGCCGACGAGCCCATCTCCAGCCTCGTGC
CCGTTGTGCCCAAGGCGGTTCCTCAAGTCGACCTCTCGGGAGCGCAGAAC
CTCTTCTGGGGCCTCCAACGTACCCCCGTCATCAGGTGGACATTGGGCGG
CGTGTCGACCCGCGTCGACTGGAACCATCCCACCCTTCA

Sequences in the Contig:

SY0AAA30YC10FM1 SY0AAA35YL06FM1 SY0AAA45YB20FM1