Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1231
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00004488001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_10565
Accession: ref|XP_366347.1| Score: 275 E_value: 5e-23
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g113 Score: 275 E_value: 2e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9Y7I8|YOI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1231
TTGGGGATAAGAAGCGAAAGGAGGAGGAGGAAGCTAGAGAGAAGGCACAA
AAAGCCGACTCCAAGAAGGCCAGGGAGGCGGCCAAAAACGCTGTCAAGAA
GAACAGACGCGTTCTCAAGGGCTCCGTCAAGGATGTTAATTACTTTGCAT
CTGGGGACGCAACCCCCGCCGTTATTGACAGGGTCCTTGGCGAGGTCGAG
CTTGTCATCTCGAAAATCGACAACGAGGATCTCCAAACTCTCGCTAGGAA
CCTCAGCGGTACGAGGGGCGCTGACGCCATTAAGAGCACATGGGTAGAAG
CTGTCGGCGAATTGGTTAAGAAGGGAAATGCAAAAGTGGAGGATTTCAAG
GTTTTTACATCTTAACGTACACCTATATTTATATCTATCGGGGGTATGAT
GATGATGATGATGATGAAGTCCTTTGGGTTGCTCCAAGAAAAAGCAAAGC
TACATAGAGCCCCGCAAGTTCATGTCCTAAAAAGCGTTCATCCCTTTCTT
CGTTATTGTTATTATTTTAGAGTTTATGTGGGGTAGAAATGGATGGATGG
CCTTTTGATTCT

Sequences in the Contig:

SY0AAA45YB14FM1 SY0AAB58YC09FM1