Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1230
Length(NT) : 719
Best Gene Model Blast : Link to GSTUMT00008768001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_04444
Accession: ref|XP_001594637.1| Score: 308 E_value: 1e-26
KEGG Definition: origin recognition complex, subunit 3; K02605 origin recognition complex subunit 3
Accession: aor:AO090103000039 Score: 297 E_value: 1e-25
KOG Definition: No Hit Found
PFAM Definition: ORC3_N, Origin recognition complex (ORC) subunit 3 N-terminus. This family represents the N-terminus (approximately 300 residues) of subunit 3 of the eukaryotic origin recognition complex (ORC). Origin recognition complex (ORC) is composed of six subunits that are essential for cell viability. They collectively bind to the autonomously replicating sequence (ARS) in a sequence-specific manner and lead to the chromatin loading of other replication factors that are essential for initiation of DNA replication..
Pfam Number: pfam07034 Score: 198 E_value: 2e-16
Swissprot: Q32PJ3|ORC3_BOVIN

Sequence:
>Contig1230
TGGACAAAAAAGTTGGCCTCAACAATCCACGCGACAAATCATGGAGTCAA
CTCCGCCAGAAGAAGTTTACGTTGATGAATTCGACCCCAAGGAGCACCAG
GGATGTTACATTTTCACTCTGGACGGCGAAGAGGATAGGCCGACAAAGCA
CCGGAAGACTAAAGGCAAGCAACGTGCTACGGAGAAAGCAGTTGTAGAGG
AAGAGAAATGTCCTTTCCCTGTGCTATTAGATGGTAAGGAGACAGAGAGT
ACCATAAAGCTCAGATACCGGACGTATTGTAAACTTTGGGAGGCGCAAGA
AAAGAGAACGAAGGCTATTCTGGATTCTTTCAATAGCAAGACTCTGGATG
ACGTTTCAACTTTTGTAAAGGATGCTACGCCAGAGAAGTACGAAGGGAAG
ATCCCCACAGCGCTTGTTCTCGCCGGTCCAAACATTGCGTCGCACGAGCT
GCTATTCGAACAGCTAGCTCAACGGATACGGAGTCAGGATAGGACTGGAC
CAGTTGTGGTCCTGACCTCTAAAGATGCTACCAACTTAAAGACCATTCTC
AGGAAATTGATCAGGGACGCTACACAACAAGATGAAGGCGTAGATGACGA
AGAAGAGGATATTGTTCGCAAGAGCACGAAATTACTCAACTACGATCTAC
AGATCTTGCAGATTTGGTGTGAATTACACAAGGGTCAGAAGGTCACCGTT
GCGGTGCAAGATTCTGAAG

Sequences in the Contig:

SY0AAA28YO01FM1 SY0AAA34YA17FM1 SY0AAA39YL07FM1
SY0AAA45YB11FM1 SY0AAB55YN07FM1 SY0AAC10YA06FM1