Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig123
Length(NT) : 489
Best Gene Model Blast : Link to GSTUMT00004847001 E-value : 4e-96
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig123
TTGGCTCCATCTCACAGCACACCGCGTTCACCGCTCGATTAGTCATATCC
TTACTCATGAGCAGTCTGCTACTATGGCATTTCACCGTTGAGACCCTAGC
TCAAAGGCTGGGGATATTCCCATTCCAGGCAATGAACATATCGTGGACTG
CTCAGGTGGTGTATATGTGGCTGATGACCTACCACAACCACAATAAACCA
CCACCACCACCACTCACAACGAACTCTCTGAGATAACAACTCATTTCCTC
CTGAGCAGAAGATACCTTACCTCTACCAACCCCATCAGCTAAACATCTTC
TTCATCTTAATCATCTCAGCCTCATCCGTTGCCTCACTCTTTACACGTCG
TCAGCTTCTAACTGCTACGCTGATACTCTTCCTTCCCCTCCATCGCTCCT
TCTCAACGAGCTTAAGATAACTTAAAACTCTCGTCATCATGAATCCCGAA
TACGATTATCTCTTTAAGCTCCTTCTCATCGGTGACTCA

Sequences in the Contig:

SY0AAA14YJ15FM1 SY0AAA4YB16FM1 SY0AAD25YH12FM1