Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1229
Length(NT) : 1644
Best Gene Model Blast : Link to GSTUMT00009337001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: NRPS-like enzyme, putative
Accession: ref|XP_001268116.1| Score: 1154 E_value: 1e-124
KEGG Definition: non-ribosomal peptide synthetase/alpha-aminoadipate reductase and related enzymes
Accession: aor:AO090001000516 Score: 1147 E_value: 1e-123
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1221 Score: 208 E_value: 4e-17
PFAM Definition: NAD_binding_4, Male sterility protein. This family represents the C-terminal region of the male sterility protein in a number of arabidopsis and drosophila. A sequence-related jojoba acyl CoA reductase is also included..
Pfam Number: pfam07993 Score: 299 E_value: 1e-27
Swissprot: Q6FMI5|LYS2_CANGA

Sequence:
>Contig1229
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACAGACGAAGGCATGGAA
GCCATGAAGATATGCAAGTCGGTTTGTTCTGGCGGGTCCGCATGTCCAGA
GGAATTGGGAGACAAGCTCGCCGCGGCCGGAATTACACTCGTAAGTTACT
ACGGATCAACCGAAGGAGGAGCCCTCCTCAACTCCTACCGCCCCGAATCC
GACAAGGATTGGAACTACCTCAAAGCCATCCCACCCGCACTCCCCCATAT
CCGCTGGGAAAAGTACAGCGAAAGCGTGTACGAGCTCGTCCTCCTCGCCG
GATGGCATGCAAAAGCCTTCACCAACAACCCCGACGGCTCATACTCCACC
CGCGACCTCTGGCAACAACATCCTACCGACCCACTCAAGTGGAAGTACGT
CGGCCGCCTCGATGACACTATCGTTCTTTCAAACGGGGAGAAAGCTAGCC
CCCTCGCTCTCGAGGGCTCGGTGAGGGACAGTCCATACGTCAACGAGGTC
GTCTGCGTCGGTGTTCAACAACCCACCCTGGGACTCTTGGTTATCCCCAC
CGAGCGAACCATCGGAATGTCCCGCGCGGAGCTCATCCAGAAGATGAGGC
CATCTATCGAAGCTGGGAATGTTCGTATGCCAGCTTACGCTCAGATTTCC
GCTGAGATGATCGGCTTCCTGCCAATAGGGACACCCTACCCGGCAACAGA
CAAGGGCACCGTGATCCGTCCTGCGTTCAACAGAACCTTCCGGGTGCAGA
TTGAGTCCATGTACTCCAGGTACGAAGAAAACAACGCCTCTGAAGGCCTT
TCCCTCTCAGAAGAGGAATTGAGAGCATACGTCCGCAACACGATCATTAA
GACTCTAAAACTTGAAGACACCACCGCCCTCCCTGACGACACGGACTTCT
TCTCCCTTGGCCTGGACTCCCTCGGGTCAATGCAAGTCCAAGGCAGCATC
CGTCGGGAACTCAACACGGGCAAGCAAATCGGCCAAAACGTCGTCTTTGA
GAAGCCGACCGTGAGGAAACTAGCTGGGCACTTGTACCGTCTTCGCACCG
GAGAAGTGGAGAAGGAGGAGGATGAGCAGTCCCAGATCGAAATTATGAAG
GGACTGGTAGAGAAGTACTCGCACTTTGAACAACACGTTCCCGGAAACTC
TGATAAGCAGGGCGACTACATCATCGTAACCGGCGCAACGGGCTCGCTAG
GCGCACACCTAGTCTCCCAACTCGCCACGAAACCCACCACGCAAAAAGTA
TACTGCCTAGTCAGGGCCAAGGGTCAGCCCAACGCCCACGAGCGCACGAT
CCAATCCCTAAAGCTCCGGCGGGTATATGAAGACTTATCGGCCACCTCCC
TCTCCAAGATCATCGCTCTACCCTCAGACTTCAGTGACCCGCGCCTCGGC
CTCTCGGAAGACGTCTACGCCGAGCTCCTGGACAGCGTCAACATTGTCAT
TCACTGCGCCTGGCAGGTGAACTTCAACATGGACGTCAGCTCCTTCGAGA
ACGCGCACATCAAGGGCTCGCACAACCTCATGACGCTGTGCCTAAAATCT
CATCGCTCGAGTCCTGCCTCGTTCAATTTCTGCTCGAGCATTTCATCTGT
GGCGAATAACTCCACCGCAGAGACCATTCCCGAGACACAGCCGA

Sequences in the Contig:

SY0AAA45YA24FM1 SY0AAC61YF15FM1 SY0AAD12YK04FM1
SY0AAD39YO02FM1 SY0AAD61YD12FM1