Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1228
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00000102001 E-value : 1e-121
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 148 E_value: 3e-16
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 148 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1228
TTGGCCGGTATCCTGAGCAGAAAAGATCGGAAAATGTCCTCAGTATTGAG
TAATAATCTCAACTCTTTTAACACGACCATTATCAACCCTACTGCTCTCG
GTGACCGATCAGATATCCTAGCCTGGTTATCCCCACTAGATCCCAGGTTA
CGACATCAGGATATTCGAGACCGCCGCGTCGAAAATGTAGGGGAATGGCT
CCTGAGAACCGATGAATTTTAGAAGCTGGTATGCGGGGAGTGGAGGAGAT
GGATCTGATGAGGCAGTTTTGTTTTGTTATGGAGATCCGGGGGTGGGGAA
GACTTTTATTAGTTCATTGGTGATGGGCAGCTTGTGTGACCAGGCAGGAG
GACGGAATGCTACGGTTGCAGGTTTTTATTATGACTTCGCCGTCCAAAAG
GACCAGACCCTCACGAGAATGCTGGGACCCGTGCTGAAACAGCTGATTTC
CGGGCTGGAGGAGATCCCAGAGGAGATATCGCAAGAATACCGAAGCCAAA
AAAAATTCCCTCGGTGGACGGGGACCACAGCTGTCTGAGATTGTGAAGAT
GATCCAGGCCACCTCATCGAAAAAGCCTACGTTCATATGCATTGACGCTC
TAGATGAATGTGCGGCAGGATATAGAGTCAAGCTTCTTGACTTGCTAAAC
AAAATTCTCGAAAGATCCCCAGGCACTCGAGTATTCATGACGGGGAGGCC
ATACATCCGA

Sequences in the Contig:

SY0AAA30YB23FM1 SY0AAA43YL03FM1 SY0AAA45YA21FM1