Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1227
Length(NT) : 975
Best Gene Model Blast : Link to GSTUMT00000173001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_04258
Accession: ref|XP_001557648.1| Score: 614 E_value: 7e-62
KEGG Definition: GTPase activating protein (Gyp5), putative
Accession: afm:AFUA_4G10600 Score: 594 E_value: 7e-60
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4643 Score: 118 E_value: 6e-07
PFAM Definition: No Hit Found
Swissprot: Q755I4|GYP5_ASHGO

Sequence:
>Contig1227
TTGGCTCGAAGGACCGATCCTAAAATTTGGGATCGTCCTCATGGGCAAAA
ATGCCGAGGCCTTGACCGGAATGGAATTCGATGCTCTGGGACCTTTCCTG
AAAGAACGGCTCTTCGATGTTTATCTCGATACGGCGCCGAGCGCAACAAG
TGTTAAGGAGGCGGGATTTTTTGGGAATGGTGGTGAAAAGGATTTCTATA
GAGCCAACCAAATGGTCCAGGACGCTTGTGCTATCAAGATAACGCAAGAT
ATGCTTGACCGCTACGAGAGGGAGTGGGATGAGATAATGCGGGCCAAGAG
GGAACACGAGATGGAACTCGAAACTTTGCGGAGGACGAACGCTGGTCTAA
TGGTCAAGGTGAAAAAACTAGAGGAGCAGAATGAAGAGTTGAACAGAGAA
TATGTCAGAATCGCTAGCAGTGAGGTTGGCTTAAAGGTCCAGAATGACCA
GTTAGCCGATGAGAACGAGGTTCTCAAAGCAAAGGTCGAAGGATTGAAAG
AAATCGTCGACAAACAACCGCAAGAAATAGAACTGCGTTTCAAGGAAGAA
ATGGACAAGCTCATGACACGAACTCTAGAAGTGCATACGGAAAACCAGAA
TCTCGAGGAGAGCATGTTAGAGATGGAAAAGGATTTGGTAGGCACGAAGA
TGCAGCTAGCTACTGTTAACGAGGACTACGATCTTCTCAAGAACAGATGG
AACGATCTCAGGAAAGCACTTGGGGATTAAGGTGCCCCTCTTCCCCCGTC
CAAATATCTGTATTTGGATCGTATCCACCCGGTAGTCTATTTTTATAACT
ACCAAACAAAATATACCTCAGCGATTCCTTTCTGTCTTTCATGCTCCATC
GGACACCTGCTCTCTTTCATTACATTCATAAAAAAATTGTGGTTTCTTTG
TCCAATAGGCTTTCCCGTCCACTTCCCGATGCCCGATAATGATTACAGAG
GGCAAACGAATTTTTTCCAATGTAT

Sequences in the Contig:

SY0AAA45YA11FM1 SY0AAD50YE12FM1