Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1226
Length(NT) : 1079
Best Gene Model Blast : Link to GSTUMT00011132001 E-value : 6e-97
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1226
TTGGCATAAATCTCTGGCAATGTGGACCTACATGCTCCTCACCAGAACGC
AGTCGTAGGTGATACTGTTGACCTAAATGCTCAGCATCTGTTAGCCCGCA
ATGACTGCCCCATCTGATGGCAGACGACCAATTTGCTCCTCTGTTTATGC
ATCAGTGGGATGTCCAGCAATACAAAACACAGTTCGAACTAAATCACACT
GCAGGTACACGCCTCAGGACACTTCGATACTGCGGGTAGGAGACCAAAGA
TGGAAAGCGCCCATAGTGGATTTAGTAGCTGTCGGACTTAGCGTGATTCT
GTGGATCTTCTGGCTTGGAACTACTGCGGTCGTTGGCTATGCCGCCTGGT
ATTTCCGCCAACACAGTGTCTCCCCATTTGAGTACCTAGCCCGGCAGGAC
ATGACATTGAGGAAACCACCAAGAACGCCTCTAGTCCTAACGACGAATTG
CCCTCATTAATAGAAACCCGGATGAGGACGACGGCGACAACAGACCCTCC
TCCCATCACGGACGTAGTGGAAGTGTGACCAGCTACGATACTAGTTACGA
TGCTCACCCCGATAACCCTATTCCTTGGGGCGGCGAAGGAAGCGCGTAAA
ACGGAATCGGAGGACACAGACTAGTGGCTATGGGCGAGAATAGAGGAACC
CCCTCGGGGTTAAGCTTGCCCATCGCTCCGGATGAGGATTATAGCTACAG
GGGAGTGGCAGTGTTTTCTGAGTTTTCCCTTGTCTTCCGGCATCGTCTTC
CTAATCGGGGGCTTTGTAGGGCCATTCCATATCTGGCATCATGCAGACGT
CCTATATCACGGGTCACTGATACCCACACCAACATCCATGGCTGCCAACC
ACCGCCGTACCCCGACCGATGCAGATCTTGCTCAACCTGATGCCGTTGGC
TAGTCGTGATCATCACCGCGCATCTCGTACCCCCACCATAATAGCCGTGT
CCGCTCCCGTCCCGTCGTCTGGATTAGGACGTGGTTGTGGTCTATTCTAT
AGCTTCATTCAACTCTGTGCTGGTGGGGGAACAACGTCATTACATAAACC
ATGAAGGTAGTTTGTGCTTTCCTAATTAA

Sequences in the Contig:

SY0AAA34YO09FM1 SY0AAA45YA04FM1 SY0AAA8YH13FM1
SY0AAB43YH04FM1 SY0AAD39YO23FM1