Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1225
Length(NT) : 1764
Best Gene Model Blast : Link to GSTUMT00008543001 E-value : 0.0
Numbers of ESTs : 33

Blast Results:

Nr Definition: Tubulin beta chain (Beta-tubulin) emb|CAA93254.1| beta-tubulin
Accession: sp|P53373|TBB_BOTCI Score: 2121 E_value: 0.0
KEGG Definition: beta-tubulin; K07375 tubulin beta
Accession: mgr:MGG_00604 Score: 2100 E_value: 0.0
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1375 Score: 1455 E_value: 1e-161
PFAM Definition: Tubulin, Tubulin/FtsZ family, GTPase domain. This family includes the tubulin alpha, beta and gamma chains, as well as the bacterial FtsZ family of proteins. Members of this family are involved in polymer formation. FtsZ is the polymer-forming protein of bacterial cell division. It is part of a ring in the middle of the dividing cell that is required for constriction of cell membrane and cell envelope to yield two daughter cells. FtsZ and tubulin are GTPases. FtsZ can polymerise into tubes, sheets, and rings in vitro and is ubiquitous in eubacteria and archaea. Tubulin is the major component of microtubules..
Pfam Number: pfam00091 Score: 727 E_value: 3e-77
Swissprot: P53373|TBB_BOTFU

Sequence:
>Contig1225
TTGGCCCATCGTCATCCTCCCTTTCCTCACCACCCACTCTCTTGCCACCA
ATTCATCTATCATCCTCCATCCCTTTTATCATCCTCTGCCCCCCTCCGTC
TTACCATCTCCCTCTTAAGTCCTATTATCAAGCTTCTCTACAGCTTGCCT
TTTTTTGCGCTCTTAAGCTTTCTTCATCTTTAACCAGAATGCGTGAAATT
ATTCATCTCCAAACCGGACAATGCGGTAACCAAATTGGAACTGCTTTCTG
GCAAACCATCGGTGGAGAGCATGGTCTTGACGGGTCTGGAGTCTATGGAG
GAACCTCTGATATTCAATTGGAGCGTATGAGTGTATACTTCAACGAGGCT
TCTGGAAGCAAGTATGTGCCACGTGCGGTGCTCGTTGATCTTGAGCCTGG
TACCATGGATGCGGTTCGCTCGGGTCCTTTTGGCCAACTCTTCCGCCCTG
ACAACTTCGTCTTTGGTCAATCTGGTGCTGGTAACAATTGGGCCAAGGGT
CATTATACTGAGGGTGCCGAACTCGTTGATCAAGTATTGGATGTCGTCCG
TCGTGAAGCTGAAGGATGCGACTGCCTTCAGGGTTTCCAGATCACTCACT
CACTCGGCGGTGGCACTGGTGCCGGTATGGGTACCTTGCTTATTAGCAAG
ATTAGGGAGGAGTTTCCCGACAGAATGATGTCTACCTTTTCAGTTGTTCC
CAGCCCTAAGGTCAGCGATACTGTTGTGGAACCATATAACGCCACTCTCT
CTATTCACCAGCTAGTTGAAAACTCTGATGAGACTTTCTGTATTGATAAC
GAGGCTCTTTATGATATCTGCATGCGAACGCTTAAGCTTGCCGCTCCATC
CTATGGAGATCTCAACCATCTTGTTTCAGCTGTCATGTCGGGTGTCACCA
CTTGTCTTCGTTTCCCTGGCCAATTGAACTCTGACCTCCGCAAACTTGCT
GTCAACATGGTTCCTTTCCCCCGTCTCCATTTCTTCATGGTTGGGTTCGC
ACCTCTCACATCGCGTGGAGCCCACTCATTCCGTGCTGCCACTGTTCCAG
AACTCACCCAACAAATGTTCGACCCGAGAAATATGATGGCTGCTCCCGAT
TTCCGTAATGGACGCTATCTCACCTGTGCTACTATTTTCCGTGGAAAAGT
TTCTATGAAAGAGGTTGAGGACCAGATGCGCAATATCCAGACTAAAAGCT
CCAGTTATTTTGTTGAGTGGATCCCCAACAACGTCCAGACTGCCCTTTGC
TCGATCCCACCTAAGGGATTGAAGATGAGCGCTACCTTTATCGGAAACTC
TACCAGTATCCAGGAAATGTTCAAGCGTATTGGTGACCAGTTTACTGTCA
TGTTCAGGAGGAAAGCTTTCTTGCATTGGTATACTGGAGAGGGTATGGAT
GAAATGGAGTTCACTGAGGCCGAGTCCAACATGAATGACCTGGTTGCTGA
GTACCAGCAATACCAAGATGCCGGAATCTTTGATGATGAGGGAGAGGCAT
ACGAGGAGGAGTTGCCCGCTGATGGCGAATGATATTTGATTGATTTGCCT
CTTGACCGTGCTAGTTTAGAGCAATAGGGGAGGAGGATGGAAGCATGATC
GGAGGTGGATCTGTATGTTTTATTCATTCTTACTGTATCGGATTTAATAT
CTATACCCATCTTTGTGTGTTTTGTTTTGTCGGCCTAGGCGTGAAAGTGG
TTGATGGTTGGGAAAAATTTTTGGAATTTGAATGGCATGCTGTTGGTGGG
AATTAATGCAATGG

Sequences in the Contig:

SY0AAA11YE01FM1 SY0AAA15YA13FM1 SY0AAA18YM14FM1
SY0AAA24YF20FM1 SY0AAA24YF20FM2 SY0AAA37YN01FM1
SY0AAA44YP07FM1 SY0AAA5YM16FM1 SY0AAB34YM05FM1
SY0AAB36YP01FM1 SY0AAC20YC12FM1 SY0AAC20YC12RM1
SY0AAC26YD12RM1 SY0AAC28YH14FM1 SY0AAC46YJ03FM1
SY0AAC53YP02FM1 SY0AAC55YE01FM3 SY0AAD11YE08FM1
SY0AAD15YP16FM1 SY0AAD17YP16FM1 SY0AAD19YB17FM1
SY0AAD22YB17FM1 SY0AAD27YJ14FM1 SY0AAD31YG11FM1
SY0AAD34YI01FM1 SY0AAD34YO09FM1 SY0AAD36YA16FM1
SY0AAD40YA13FM1 SY0AAD41YH02FM1 SY0AAD49YB10FM1
SY0AAD55YE08FM1 SY0AAD56YD14FM1 SY0AAD62YJ03FM1