Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1224
Length(NT) : 1967
Best Gene Model Blast : Link to GSTUMT00011316001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001594702.1| Score: 1066 E_value: 1e-114
KEGG Definition: hypothetical protein
Accession: ncr:NCU02781.1 Score: 1035 E_value: 1e-110
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1523 Score: 823 E_value: 3e-88
PFAM Definition: No Hit Found
Swissprot: P78774|ARPC1_SCHPO
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0005885 = Cellular component: Arp2/3 protein complex
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0030041 = Biological process: actin filament polymerization
GO:0000917 = Biological process: barrier septum formation

Sequence:
>Contig1224
ACTTTTTCGCTTCGTCTACCTTCTTCTCCTCCGCCTGCTGCTGCTTCTGC
TGCTGCTGCTGTTTTCCCTGTTCCTTCTCCTTGACCTGTTCTTGCTTTTG
CTGCTTTTGCTGCTTCTTCGATGGCGTGGGGGTCGCGGGGGAGCCGTTTT
GGTTGTTGCTACCGGTTGTTGGGTCTTCTGTCAGTGCAAGGCTGGCCTTG
AATTTCTTCAAGTTTCGCGAAACTGTAGATTGGTTGATAGCTTTTTGGAA
GGTCAGCTCGAACCACTCGGCGAGCTCTCTCTGCTTAAGATGTGGATTCC
TAGTCGAATGTAGGAACAATTGGTGCTTCTCCTCGAGAGTCGCCTCTTCA
TGTTTTCGCTTCTTGGAGCTCGACACGGACGATGCATTTTCCGGGGAAGC
GCTTCCCTGCTCCGGTTCCTCGACCTTCATGATTGATAGTCGTATAAGGA
GTATAGGAGGGGAAAAAAAAGAAAAAAGCTCTGATATGGGGAAGAAGCTG
GGAAATAATTTTCTTGTCCTCAATTCCTCCCTTCCTTTCTTCCTTTCTTT
CTTCCTTTCTTTTTTTTATTTTTTCTTTCCTTTTCCTTCTTTTCAACGAT
GAAGAGTTTTTTTTTAAAAAAAAATTAGGGTAGGGTAAGGGGTGGTAAGG
TAAGGTCAGGTCAGGTTTTGGTGGGGTTGAATATGTATGGGTGTGTGATG
ATGATGAGGTAGCTAGCTCTGTGGAATTAGACAAGGCCTTGCACGAATGG
TACTCCGGACAGTCCGACAAGTCCAACTTGAATGATGGCCCAATAAGGGC
GAAGGCGGAAGAGATCAATTCGCAGCTATACCCCGACGAGAAGACCCGGA
AGCAGATTACCAATGCCTGGATTTGCTCCTGGAAGCTCAAGTACGCCATC
ATCCAGCCAGGCACGCCCGTCAGTCCAAAGATTGAGAGTCGGCGGGGAGC
GGGAGCGGGAGCGGGAGCGGAGGGAGACAAAGATAGAGATGAGGATGAGG
AGATGAAATCAGAGGGAGATAGCGTCAGCAGCACCGCTTCTACCCCCCCG
CCCAGGGCAGGCGAGTCGGAGGAGAAGAGAAGACGGAAGGAGATCAAGAG
GCTGAGGAAGGATATTGAGAAAAGGGACATTCAGATGGCGAAGGCGAAGA
TAAGGAAGGAAGCCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTT
TGTACAAAGTTGTCCCCCCAACTTCAGTGATAGTAGAGTGCTGCTCCTAT
CGCTACCCACATCATCTATCATGTCTGAAGTTCACCTCCTCTTTCACCAG
CCCATTGCCGATCACTCCTTCAGTGCGGACAGGTCTCTCTTAGCTGTATC
TCGGGATACTAAAGTTGAGCTCTATAAACGTTCCGGGTCGGGATTCACCC
TTCAGGATGAACTGGCTGGGCATGACAAGACTGTTACTAGTGTTGACATC
GCACCGAATACTAGGAGGATTGTTACTTGCTCCCAAGATCGTAACGCTCT
AGTCTGGGAACCATCCCCAACAGGCTGGAAGCCAACTCTCGTCCTACTCC
GTATCAACCGTGCTGCAACACACGTTCGTTGGTCCCCTGACGAGACCAAA
TTCGCCGTTGGCTCCGGTGCGCGTGTCATCGCTGTGTGCTACTTTGAGGG
AGAAAACGACTGGTGGGTGTCAAAGCACATCAAAAAACCTCTCCGTTCCA
CCGTCTTCTCACTCGCCTGGCATCCCAATTCCGTCTTACTCGCTGCCGGT
TCCGCAGACGCTCATGCCCGCGTGTTCTCCTCGTTCATCAAAGGTGTAGA
CCAACGCCCTGAGCCAACCGTCTGGGGAGAGCGTATTCCCTTCAACACTG
TTTGCGGGGAATATATCAATAGCTCTGGTGGCTGGGTCCATTCAGTTGCT
TTCTCGCCTTCTGGAAATGCACTTGCATTCGCTGCCCATGACAGTAGTGT
TACCGTTGTGTACCCGT

Sequences in the Contig:

SY0AAA31YL20FM1 SY0AAA44YP05FM1 SY0AAA7YJ08FM1
SY0AAA9YC05FM1 SY0AAB2YC10FM1 SY0AAB49YP15FM1
SY0AAB52YC10FM1 SY0AAB59YJ17FM1 SY0AAC27YP04FM1
SY0AAC56YG20FM1 SY0AAC6YE23FM1 SY0AAD16YA15FM1
SY0AAD21YG01FM1 SY0AAD21YL05FM1 SY0AAD28YI15FM1
SY0AAD9YD24FM1