Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1223
Length(NT) : 1059
Best Gene Model Blast : Link to GSTUMT00007014001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_14103
Accession: ref|XP_001547330.1| Score: 158 E_value: 6e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG08490.1 Score: 140 E_value: 4e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1223
TTGGAGAGGAGCTACTTCGAGGGATATATCCTGATATGCATGAGATAGCA
GCCAAGGAAAAGGAAGCCCTGATTGCATCGTATTTACCGGAAGGAAATGA
TACTGCCACTATTTCTACTTCGTTCAAGAACAGCCGAGTAGGAAGTTATG
CCGGGACCCTGACACCTTTCGGATCTCCTCACGCGCAGAAGGCGAAAATA
AAAGCGAGCAAGGAGTCTATTAGAATAGGGGCCAGCCCAACTACTGAGCC
ACATGCAGGTGGGGAAATGATCTTTGATATGGATGGGGAGGGCTCGGGAA
TTGGTTTTGCTCTCGAGGTAGCCAAGGCTGAGGAAACAGGGCTTCGAAAT
GCGTGGGCTTCTCCAGGGACCCCGTCCAAAGCCACCCGAACAGGATGGTA
TCCTAGTCCAGCCTCTAGTATCCCAAGAGCATCAGGTGGCTGGGTGGATG
TAAAGGGTAAAAGCATTGGTACCCCCTCATCCAATCCGGATTTACAACTT
CTAGCCGGTGGTTCGCCTCGTTCGCATGAATTGCCTACTCCGACCAAAAT
CCCGACTACACCATCCAAACCATGGGGAGCTTCTCCGATATTGTTGGGAG
ACAAGAAACTAGACATGAAGGAGATAATGAAACAAGCATCTTCATCCAGG
AAATCTAATTTGTCGACCGGCCTGTCTTCTGAAGGAAAGCTCGCTCCCGC
CAAGTTATCGCAAAAGGAGCGAAAGCGACAGGCAGCACTTGTTGCAGCTG
CGTCTTCAGAGTTAGCCGTTTCTACTGAGATTGAAACCCCGAGCACAAGC
TCTGCGAAGCCCGCATGGGCAACTGCGAGTACCAGTGCGCGAGTTAGTCT
TAAAGAGGTCCTAGACAGCGAAATTTCGGCACCTGCGCCACCTAACATGC
CGACGCCCCAGATGCTAAAACAGAGAACCGGAGACGGTGGCGGGCGGGCC
TTCAACCGAATGATGTCGACAACAACCCCATCGGCAGTTCCACCTACCAC
ACCAACAGCCCAAACCACACGCTCTTCACCACCAATCCCGGGCACATACC
GTCCACGGC

Sequences in the Contig:

SY0AAA44YO08FM1 SY0AAB9YM06FM1