Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1222
Length(NT) : 1987
Best Gene Model Blast : Link to GSTUMT00006175001 E-value : 0.0
Numbers of ESTs : 27

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3771 Score: 113 E_value: 5e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1222
CCCATCCATCACACTCTCGCCTTTCTGGATTTCAATAAAATCCCTCAGCA
TCTTCCACCCATCTCCATATCAGCAGCTCTCCATCCAGCTTCTGCGCAAC
AAATACCATACATTCAGACGATCTTCGGGGCCGTCCGTGTTTCTCATCGC
CAAAAACTTAGACCGCTCCCACCAACCCTTTATAAAATCCTGTCTAAGAT
AAAATAGAGCCAGAGCGAGCTCGATATCGATACACGAAAAGCCCTATCCA
GCCTTCCGACTATCCGGTTCCATTATAACTCGAAGCTATCCGCACACTGG
CTTCAAACAAGAGAAGACGTTCCTCGGACGACAACACTTCTCGTTCAACG
AGCCCTTACAGCAAACTCGCTTCCTACCCATCCAAAGCAGCAAGAATGCT
CCTTTCACTACCAGATCCTCGCGAATCTTCACGCTCGAGGCGTTCCCCAC
TCACTCCTCCTTCGGTAACCCCTCCTTCGGTCAGCGGCGTAACTGGGTCA
TCGACCGTGCAGAGTGAGAGGCATCGGTGCACTTCGCCTTCACAGACAGC
GACAACATTACTCGCAAAAGTTGCAGCTCCTCAACCGCAGACAGGAACTA
CACCATCATCTCCAAGAATGGCAATGTCGAATTCGAGCTCTGCCTCGTCG
ACACCACTATCGACGCCCCCCGGGGATGGTTGCCATTTCCCGTTCGGCTC
GATGCAGAAGGGTTTGCCTGAGAGCCCCGACGGTGGTTACATTAGCTTCC
CAGTATTCGAGGAATTCGGAGACTACAAATCTGAGGACGAGGCGGGGTCT
CCTCCTCCACCCCACAAACGGTGACTAGGATCGCTCCAACTGGAGGATCC
GGAAGATGGTCATGGCAATTGGCGGATCCTCGGCGAATTGTACAAAATCG
GTCGTTTATTTTCGGTAACGGCGCATCAACAGTTTTTCAACATTCAGTTG
TGAGCAGGGGACGGAAACTAATCGAAAGGAAGAAAGAAAAAAAAAAATTC
ATAAAATCCACAAAAAAATCCACATAACCGGCTGTGCATATTATCGGTTT
TTTTCTGTTAACTTTCATACGGCGCGCGGGCTCATTGTTTGCTTCTATTT
CCCTCTTTTCTCTATCTACAGGCACATTCCCTTTTTTTTTTGGAGCATTG
TTCTACTACTCATTACACTTTCTTGTTTATTCTTTATTAAAGTTTTGACT
TCCTTTCCTTTATTTCCACTCTCTTGTTCTACCAAAAGCACTGCCACTAA
GGGGGAAAGCGGTAGGGAGTTCTTTCATTCCTTACTCTTCTATCCGAAAA
TATTTCTTTCCTTGGTTTTGGTTTAGTTTGAAAGTACGAATAGGTTCACA
ATAGTGGCGACTTGGACAAGTCAGGTGGTTCTTCTTCACTTAACCTCAAC
AAATCCTTTTTGCCTCCATTCCATCAACAAATCTTCATGTATTTTGGTGT
TAACTCTTTTTTATGGGGGGGCGCGTCTTATCGGCATATACTACATCTCG
GGCGCCTGACATGAAAACAATGGGACGGCGCGAATTTTGGCATTTTTACT
TCTATTTTCTACATAGTTTTTCTTTTTCCATCATTCCCTTCTCTTCTTCT
CCGGTGGGATGGGAGGAACCTGGCTGGTGGGATAATCACTCTACGGTCGA
TTGCGGCTAACAAGATGCCTTTTTGTTTTTTTTCTTCTTGTCAACAAATA
TCTCTTTGCTCTTTGCTGGATGCATCATAACTTTTCTTTTCTTCCCTCAT
TCCTCTCTTCCTTCCCTCCTTCCACCAATCTGAATGAATGAATGAATGGA
AAGCAAAGCGCAGGGAAAAAGGATATTTGCAAAAGAACAAGAATAAAAAC
AAACATGACAACCGAGCTAACCTTAAATTCTTGTATCAAAATTATAATAT
CTTCTTGTCTTTAATTTACCATTTTTTGCCCTGTTTTTATTATATATTTA
TTTTATTTTTATTATTTTATAATATAGTATTACGATC

Sequences in the Contig:

SY0AAA44YO01FM1 SY0AAA46YP20FM1 SY0AAA6YB22FM1
SY0AAB28YM16FM1 SY0AAB36YH03FM1 SY0AAB37YB07FM1
SY0AAB59YH23FM1 SY0AAC13YF02FM1 SY0AAC20YE22FM1
SY0AAC20YE22RM1 SY0AAC28YB01FM1 SY0AAC28YB01RM1
SY0AAC37YJ02FM1 SY0AAC42YO12FM1 SY0AAC61YP22FM1
SY0AAD18YP12FM1 SY0AAD22YE24FM1 SY0AAD2YH01FM1
SY0AAD35YB14FM1 SY0AAD38YE08FM1 SY0AAD3YB06FM1
SY0AAD45YC02FM1 SY0AAD45YJ10FM1 SY0AAD49YO21FM1
SY0AAD56YI12FM1 SY0AAD5YG08FM1 SY0AAD7YF21FM1