Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1221
Length(NT) : 2866
Best Gene Model Blast : Link to GSTUMT00008508001 E-value : 0.0
Numbers of ESTs : 27

Blast Results:

Nr Definition: hypothetical protein MGG_03288
Accession: ref|XP_360745.1| Score: 395 E_value: 7e-36
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03288 Score: 395 E_value: 4e-36
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0709 Score: 173 E_value: 9e-13
PFAM Definition: bZIP_1, bZIP transcription factor. The Pfam entry includes the basic region and the leucine zipper region..
Pfam Number: pfam00170 Score: 140 E_value: 5e-09

Sequence:
>Contig1221
TTGGCCTTTTGGGAGCAACCCCCGTACTTTTTCCTGTCAATCAATCAGCT
TTTTGCTCCTGCCGCTGCTCTACCTGCTACCACCTGCGACCATCACCGTT
CCTCCGGCACCGCACCCACACAACACAGCAATCTTGCAACACAGCCCGCC
TTCTTCTTCATCTCGCTACCTGTCCTGTCCTTTTCCGTCCTCTTACCCGC
ACAACACCCTCACAATTCAACAGCACAACCAAGTTCTACTCGTCCTTTTC
TTCACCACCACCACCCTCTCGCTACCATCATCAACACCGTTAACTTGAAC
CTTCCATCGTTTTCTCCCTGTTAGCATTCATACAAGTAAATATTCCTGTT
GACGCTTAACTGAAGCAGCTATCCTGTCGCTTCATCACAACCGCAGGCAT
AGCTAGATAGGAGAGAAGAAAAGTTGGGAATTAGCTTTTTCTACCTTTAC
CCTCCTGCTATCACGGACCAGTGAGCGAAAATCATCGCTACGAAAGGGCT
TTCCTCGCCTCCACGCTTGAAATGTCACAACAGAATAATAACATGAGCAG
AAACCGTTCGAGTTCATCCCTATCCTTCAACCAGGAGAACTCTTCCTTTA
ACGACATCGACGCCTTCATCGACTACGACGGCCCTAATTCGTTCATACCC
TCTCCTACTCTGTCCCGATCCTCTTTCTCCTCGTCGCAGTCAAGTACCCC
TTCCATGAACCAGAAGGTGACCAACAACAACCACTTGTCAGCTACAGGAT
TTCCCGCCCCGAGCCATCAATATGATCTTCACACCCAGCAAACGGGCTCG
CTTCCCGTGAATTCTGGTTTTTATCCCGACTTTTTCCCCCCAGCTGCCTC
CATGTCGGTTTCTCCCCATGAGAATAGCTTCATGCAACTCGACAACGACT
CTTCTGCCTCGCTAAACGGCTCAAGCGGCATGATGCCAGCCTACTTTTAC
CCCGAGAGCACCACCACTGGGGATAGCTCGGCCAATTTTGTTAATCCTAG
TTTGGTCTTGGGAACTTCACCGATAGCGATGGATAATTTAGAATCTTCGG
TTAAGATCGAAGTTCCTACCGTTACGGTCCCTCCTGTCGGTCCTACTGCC
CCTCCCATGGCTACCGCTGGTAGATTCTACGCTGGTATCCATCAACACCA
AGCTGCCTACGAGCAACAGCAGAGAGCAATCAGGGAGCAGCAACAGAGGC
AAGCACAGCAACAAGCCCCGCTATCCCAACAGCAACAGCTTAAGGTTGCC
CCGAAGAGTAATGTCGATGAACGTGTAGATAAAATCTTGACTTCTATGAA
GAGCAATGCCCCCCATCCCTCCGCCAATGGAACGCCCCCCGTTTTACCCC
ACATTGCCAAACTCAAGAAGGAGGAGGATGAAATGGATGAGGATGAACGT
CTACTTGCTAGTGAGGAAGGGAAGAAGTTGACCAGCAAGGAGAGGAGGCA
ACTCAGAAACAAGGTTTCTGCCCGTGCTTTCAGAAGCAGAAGAAAGGAAT
ACATCACCCATTTGGAGCAGGAAGTTGCTACCAAGACAAACGAAGCTACC
GATCTTCAACATGAGAATACCAGACTCAAGGAGGAGAACAACAAACTTAG
TGAACTCACTAGGATGCTCTTAAGCTCTCCTGCGTTTTCAGTGTTTTTGG
ATGCTATGCAACCGGCCGCCCAGAACGATACTTTGGAGCAGGTCCCCAAT
GCCACCACCGCACCGGAACCAAAGACTGCTCCATCCAACACCGATGCTTC
CCTTCGCCCTAATACCCGCAAGGACGTTAATCCTAACCTTGTCCCAGTTT
CCGAGGATTCTGAGTGGCCTTTGGCGTACAACACCTGGGGAACCAACTCG
CCGCAGGTGTTTAGTGTTCTCGAACTTCCACAAGGCCCCCCAAGCATCCA
GGATTTGAGTGGAAAGGTTGTTGAGGATGAGGACTGGAAGTTGAGTTCCC
TTCCTGTTGCCGATGGGTTCTTCCCCATCCGCAACGAGAAGGCTGGTATC
ATGGACCACTTCGATGAGGACGAGTATGAGGCACCAGAGGATCTCTTTGA
TGTTTACGAGGAAGAGATGCAGTACAATACTAGGGAAGAGACTGAGGTTG
ACGAGAAGAAAACTTTGGACGAACTGTTCCCTGGAACCGGTGTCGAGGCT
TTGCTCGAACGTTTGGAAATGATTGCAGGGGGTCAGGCCCAACCAGAGGA
TCTCTTTGAAGAGGTCGCTGTGGAAAAATCTCTGGAGATTGTCGAGGAGA
AGAGCGAGGAAATCGAGGAGAGCACATTGGGAGAAGCAAACAGGATGTTG
GATGCTGCTGAGGGTATCTACAGAAGGATCGGGTTGGTTGTTGGCGGCCA
GTAAACGTTATGGAGATCTGTCAAAGCCTTCATATACATTGTACCATGTC
AAACTTGCTGCTCTTGATCTTTCTCGCTTGAGCATTGGCTGGTAGGTCTT
GGAGTTTAGGTGGTTGGGAATTACACGACTTTAGACGCACGGGAGTTTTC
ATCGACCTCAGTTGCTGTTTTGATATTATTTTTACCTCCCTCCAACCAAG
CTTTGTTTCCACCTTATATCAGCCCTGTATTTTTTTGTGTTCCTTTTTCT
CTTTCCTTTCTATATGACAGAATGTTCGTACGAGTCTCGCCTCACCCTCA
TGATACCTTTCCCCTCATATCGTCTCAATTTCCTTCCAACTGTTTCTGTT
TCATCCAAACAGTGACGGCCGGACCTTGACCTGTGTCTATTCATTCCAAA
AAACCCCATTTTCCTCACATCCTGGTGCAATCCATATCACCTATTTTTTT
TTTTTTTTCCCATTTCTTACTGTTTTATACCTTACCTTACCAACTTTATT
TTATTCCTTTTCTTCC

Sequences in the Contig:

SY0AAA10YM09FM1 SY0AAA12YK17FM1 SY0AAA16YA17FM1
SY0AAA16YB12FM1 SY0AAA16YJ21FM1 SY0AAA1YE23FM1
SY0AAA29YA18FM1 SY0AAA36YI07FM1 SY0AAA38YN06FM1
SY0AAA41YB02FM1 SY0AAA44YN14FM1 SY0AAA45YF04FM1
SY0AAA57YP19FM1 SY0AAA58YF02FM1 SY0AAA60YB13FM1
SY0AAA6YL06FM1 SY0AAB13YK18FM1 SY0AAB1YE16FM1
SY0AAB34YE08FM1 SY0AAB35YE14FM1 SY0AAB35YJ03FM1
SY0AAB39YL16FM1 SY0AAB41YA09FM1 SY0AAB44YJ12FM1
SY0AAB44YK11FM1 SY0AAB9YO10FM1 SY0AAD60YP07FM1