Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1220
Length(NT) : 826
Best Gene Model Blast : Link to GSTUMT00011248001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_09730
Accession: ref|XP_001551460.1| Score: 742 E_value: 8e-77
KEGG Definition: hypothetical protein
Accession: fgr:FG09575.1 Score: 656 E_value: 4e-67
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q74ZX0|CSF1_ASHGO

Sequence:
>Contig1220
TTGGATCTACCTTAACGGATCCGAAGGCCTCTCATGCATCATGAAGCTCA
GCCCAATGAAAGCTTTACTCAATGTCAAGCAATTCCAAGACTTTCTACTT
TTCCGAGAGATCTGGCTTCCCGAAGAAATTCGCTCAAGTACACCTGCTCC
GGTTGTTACATCATCGGAGCCTTCTCCAATGTTAGTTCAAAGATACCACA
AAGTTGCAGCTACCAAGGCGTTTCCGTGGAACACGACGGTGGCGATCTCA
GAGATTGATCTACAATTGGACCTTGGGCAAGCGCTAGGAAGGACTGCTTT
GCTTATTTCGAACTTTTGGGTCGACTCTCGTAAGACTTCTGATTGGGAGC
AAACAATGTGCCTTGGGTTTGACACTATAAGGGCGTCTGCTACTGGGCGT
GCTAGCGGATTTGTTGACCTGAAAAACTTGAAAGCGCGGACTGCGATACA
TTGGCGCTCTGCTGCTGCTGATGACGCCATTCGAGCTCCCCTTATTCAGG
CTTCGTTAAGCCTTGAGCAGCTCCAGGCCAAAACGTCCTTTGATTACCAA
GCCTTCTTAGTTGCAGATATTACTCGCTTTTCCTTCCTCATGTACAACGT
TCAGAAGGATAATGGGAATGCGGGAGATCGGTTGGTGGGAGTGCTGGATG
GAGACAGAGTACATGTTTACTGTACGGCGCAGAGCGCATCCCAAGGTCTT
GCACTCTACCAAGCGCTTCTCCGGCTTGCTCAAGAGAAAATAGCATCGTA
TCAAACCTCTCTAAAGGACGTAGAGAGGTACTTGAACAGGCCTTTGCAAT
CGAACCACAACTTCCCCGCGCCCCCC

Sequences in the Contig:

SY0AAA13YN05FM1 SY0AAA44YN13FM1 SY0AAD46YO08FM1