Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig122
Length(NT) : 996
Best Gene Model Blast : Link to GSTUMT00009841001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: N-acetyltransferase
Accession: gb|EDR03337.1| Score: 498 E_value: 2e-48
KEGG Definition: hypothetical protein
Accession: spo:SPCC16C4.12 Score: 449 E_value: 5e-43
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3234 Score: 603 E_value: 3e-63
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 145 E_value: 5e-10
Swissprot: O74457|YCGC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0031416 = Cellular component: NatB complex
GO:0005634 = Cellular component: nucleus
GO:0045011 = Biological process: actin cable formation
GO:0000917 = Biological process: barrier septum formation
GO:0006897 = Biological process: endocytosis
GO:0007005 = Biological process: mitochondrion organization and biogenesis

Sequence:
>Contig122
TTGGAATAGATTAAGCAACCCGATAACACAAATCCAGTACGGGCGGGGGC
AATACAAGTTCCAGTGAATCTTGGATCATTAACCATCCCCCAAGCAATTC
AAACCATCAATCAATTTAATCCACCCCACTCCCGTCCCTCGAAAACAAAA
GAGGAAGGGAAAAAAAAAAAGGCGAAAAGAGCCTCACAAAACCACTTAAG
CAACAACAACACACCCCACCAAACCCCACCCAACACCCCCTCATAAAGGA
ATTAAAAAATATATATTTAAAAAAAAGGAAAAAAAGGAAAAAAAGGAAAA
AAGAGAATGAGCTCCCTCCGCCCCTTCCACCCCCTCGATCTCCTCCGCCT
CAACCTCGCAAACCTCGACGTCCTGACCGAAAACTACGATATAAGCTTCT
ACCTCAGCTACCTCGCGAAATGGCCGACGCTAATGTCAGTAATGGAGTCT
TCCCAAGGAAGAATAATGGGCTACATAATGGGTAAAGCCGAGGGCACTGC
CAAGGACTGGCACGGGCATGTAACCGCCGTAACCGTAGCACCCGACTACC
GCCGCCTCGGCCTCGCAAAGACAATGATGGACGAACTCGAGCGCGTCACC
ACGAGCGTGTACAACGGCTACTTTGTCGACCTGTACGTGCGTGTTTCCAA
CGAGATCGCTATTAGGATGTATGAAGGGATGGGGTATTCGGTTTATCGCA
CCGTCGTGGAGTATTACTCTTCCAGCAGCGGCGGCGGCGGTGGTGGCGGT
GGCGCTACGGTTGGCGGGGATGGGGATGAGGATGCTTATGATATGCGGAA
ACCTATGCGTAGGGATAAGCACCGGAAGAGTGTAAGGAAGAATGGGAGGG
AGGTTAAGGTTTTGCCACATGAGGTTTGGTAATACTTTAGGATAAGGTGG
GGGGGGGGTATGGGTTTATGATTTTATCTTTGGAGAATGGCAAAAAAAGG
GTTTTTCTTCTTCTTTTCTTCTTTTTTAAAACTACGGCATCACAAT

Sequences in the Contig:

SY0AAA14YI13FM1 SY0AAA8YM05FM1 SY0AAB20YA16FM1
SY0AAD22YP02FM1