Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1219
Length(NT) : 1206
Best Gene Model Blast : Link to GSTUMT00010551001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_15249
Accession: ref|XP_001805406.1| Score: 379 E_value: 2e-34
KEGG Definition: hypothetical protein
Accession: ang:An16g02040 Score: 378 E_value: 1e-34
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3623 Score: 124 E_value: 1e-07
PFAM Definition: No Hit Found
Swissprot: Q9P8W3|ACE1_TRIRE

Sequence:
>Contig1219
TTGGCAGTGAGTACACTCATCCATCGTCTGAGTCGACTGCCGCAAACGCG
ACAGCTCTCCTCCCCTCGGATGTCTCAGGAGATCATAGAGTTATGACCAG
GCACTCTATTGGATACCCCCAGGCTCCAACCCCAGCTGATACCAACTACT
CTGGATCGCCAGCGGCTCCGGCATCTTTTGAAGGACACAGTGGCAGTAGT
CACGGCACCTCTAGGAGAAAAGCTTCAGTACCAGCTGGTAAGCCTGATGA
AGAAGATGCCCCAATTTACCGCTGCGATCAATGCCCCAGAGAATTCCCTA
GACCTTGCGACCTAACAAAACATAAGAAAACCCACGAGCGCCCATTTAAA
TGTGACGATGAGGGTTGCAAGTACCATATCGAAGGTTTCCCGACCAATAA
GGAGCGTGAGCGACACCAAAACGATATACATGTTGCAAATTCAAAGGAAT
GGAAGTGCACATATTCACCATGCGCCTACAAAAGCAAGCGCGAGAGCAAT
TGCAAGCAGCACATGGAAAAAGCGCATGGTTACAATTACAAGCGGATGAA
GAGGAACCCTCGGAAACGACCAGAACAATTGACGAAGCCAGTAACCTCGG
ATAAGAAGAAGCGTGGTGCCATCAGAAAGGCGTCAGTTGCGACTTCCAGG
TCTACCACAGTCTCCAAGGCAATCAAAGCATCACGATCATCTCGGCCTGA
GGCACCCGAAGCCACGGCTTTGCCAGGGCAAGATTCCAATGTCGCTGTAA
CAACTGGGTTCGATATGTACCAAGGCTACCCTCAATCACCGACTATACAT
GGAACAAGTGATGAGTACCAACTCCTAGACACTGAGATGCCTCCTACATC
ATACTTCGATGGGTCTCCTCCAACCAATTTTGTGCCTAGCCCCGCCGATG
CTCCAATAGGCTACAATCCTCCTATGGATGCGTACCAAGCCAACCACCCC
ATGATGGGGAATTCTGGGTGGTTTTCGTCACAGAGTTCTAGCTTTCTGGA
CCCCTTTCTCTCAGAATTTGAGCAGTCCAGCGCCCCATACGATGACGGTG
TTGGTGACGATGACACTGCGGACTGATAGCGCTCATAGCTTGGTTGCATA
TTTAAGCAGCAGATATATTGACCTTCGCTCCGGCCAGGCCGTGAGATCAC
GCGGAGGTCCGAATTGCTGCCACCTTTGTCCTCCTAAGACAACCAAAACA
TCTCCT

Sequences in the Contig:

SY0AAA24YB19FM1 SY0AAA37YM22FM1 SY0AAA39YC02FM1
SY0AAA44YN06FM1 SY0AAB13YA20FM1 SY0AAB26YB22FM1
SY0AAB53YI06FM1