Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1218
Length(NT) : 715
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1218
TTGGCTCTCTGCTCGCTCGCACTCAACAACCAACCAACATATGCGGAAAA
ACAGGAGTATAAATAAACGACCGAAAGGCATCTCACACCCGCTCTATCAG
GTCCCGCTCATACCCACACCTCTCCGCTCGTCCACAAAGGAAACACTACA
AAGAACTCTCCCATTTGCCATACGACTTCTGCCGTTGTACCGTTTCCGCA
GTAGCATTGCTCCCGCGGCCATATGCCTTCCGCGCTGACAAAAGAAATGC
GAGCTTCTCAAAAACTCCCGACAAAGTCCCTTTGACTCTACCGCTTTCCT
CACGCTTTCCTCACACTTACTTCACGCCGGCACTACTCCCGCCATTATAC
GGATGTGCATTGCCATGGTGCACCCGTGGCAACCTTTGCGCCACGAACAA
AGGACGGACAAACCAGAGCAAACAAGCGAACAAGCGGGAAGGAACGGGCG
AACAGGTGGGAACAGACAAACAAACGACTCATAGACGGATAGCGGATAAA
CGGACGGCGGATATGCGGATGGTGGATAGACGGATGATGGGTAGACGGGC
GACGGGTAAGGTGACAAAGTCATGAGCTTGCCGAACGGCATCCATGATTT
CCAACAGTCACTCTCTCTTATTGTTTTTTACGATATCTCTTCGGATATAT
GGGTTAGGTTTTGACCGAAACCCTCCACTATCTATTTGCTCTATGATAGA
ATTAGTATACTCTGC

Sequences in the Contig:

SY0AAA44YM14FM1 SY0AAA61YI05FM1