Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1217
Length(NT) : 839
Best Gene Model Blast : Link to GSTUMT00002048001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001598557.1| Score: 644 E_value: 2e-65
KEGG Definition: hypothetical protein [EC:4.2.1.46]; K01710 dTDP-glucose 4,6-dehydratase
Accession: mgr:MGG_06324 Score: 632 E_value: 2e-64
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0747 Score: 450 E_value: 1e-45
PFAM Definition: Epimerase, NAD dependent epimerase/dehydratase family. This family of proteins utilise NAD as a cofactor. The proteins in this family use nucleotide-sugar substrates for a variety of chemical reactions..
Pfam Number: pfam01370 Score: 241 E_value: 2e-21
Swissprot: Q9LH76|RHM3_ARATH

Sequence:
>Contig1217
TTGGGCGGGGGGGGGGAAGAGTAGGAGGGGTCCTCTCCTTTTTCCTTAAA
AATTTCTACCCTCCTTGCGCCAGCTACTTATCTCTCCTACCTCTCACACC
CCCTCTCTTCTTTCTTCCTCTTCTTCCATCCTTCTCTGCGTCCCCAACAC
CCTCTGATTCAATCGTGATTACGAGTACTGGTATTCTCTCTTCGCTATTC
TTATACGGCCTGTACCCGCCTTGGTAAATCTCCCTCCTGTGTATTTTTAA
GCTTCAGGGCCCTTTTGGAGCTTTCCCCAAATTCCTCTTCCCCGAAGCAC
AAACCACCTTATCCAGCTAATAAAAAATGGTACCCAACAGATCTGTCACT
CATCGTCACTTTCAGGATACTGGCATCTGGAGAGATGCTCCAGTCTACAA
AGGAGCAACCAAATTTCCCCCCCTCGAGGATGCGAAGAACATCCTAATCA
CTGGTGGAGCTGGTTTCATCGCTTGCTGGCTTGTCCGCCATCTTACCCTC
ACTTATCCGGAGTACAACATCATTTCGTATGATAAGCTTGACTACTGCGC
TTCTCTGAACAATACTCGTTGTCTGAGTACTGCCCCAAACTTCACCTTCG
TCCATGGCGATATCACTTCTCCTGAGGAAGTTCAGAATGCTTTCCGTAAA
TACAACATTGATACAGTGTTCCACTTTGCTGCGCAATCCCATGTTGATTT
GTCGTTTGGAAATTCTTATGAGTTTACTTCGACCAACGTCTATGGTACCC
ACGTATTGCTCGAGTGTGCCAAGAATCATGGCTCGTTGAAGAGATTCATC
CACATTTCCACAGATGAGGTATATGGCGAGGTCGACGAG

Sequences in the Contig:

SY0AAA44YM04FM1 SY0AAB43YP09FM1 SY0AAB5YA09FM1