Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1216
Length(NT) : 1907
Best Gene Model Blast : Link to GSTUMT00002338001 E-value : 0.0
Numbers of ESTs : 104

Blast Results:

Nr Definition: acetate--CoA ligase
Accession: emb|CAA34858.1| Score: 1990 E_value: 0.0
KEGG Definition: acetyl-coenzyme A synthetase [EC:6.2.1.1]; K01895 acetyl-CoA synthetase
Accession: ani:AN5626.2 Score: 1985 E_value: 0.0
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1175 Score: 1329 E_value: 1e-147
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 652 E_value: 1e-68
Swissprot: P16928|ACSA_EMENI

Sequence:
>Contig1216
TTGGCTCTTAATTTGCCCCGTGACCTCCAGTTCCTCGAGCAGAGAGTACC
GGTAGATAAATTAGGGTCTGGCGATCCACTCACCCGGGGCATTACTGAGC
TCTTTTCGGAGTTGCCAATAACTCCTACTATTTCCCCTGGTTCAGAGCCG
TCGCCTCCTAGCACATTACAGGTGAGTACAGTATATAAAGCTGACTGCTT
GTCCCGTTCTATTCCCCTCTTTCACTTCCCGTTTGGATTATTTGGTTTTA
TCAATTGCCCCGCAGGCGTCTTACGGGTACAGTACTTAAACTTCCCCACC
CCCTCCCTCTTTCTTGAGAGTCTCATTCGCCTTTTCGATCTGTCAAATCT
CCTTTCCCCCCACGATCACTTCGATCCGTAGCCAAAATTGGTGCACTGAG
TCCAATGTTTTCGGAGGTTCTCAAATCAAATTCTACGGAAATGTCCGAAG
CAGAGGTTTCCGTGGTGAGTGAGGCGCATAATGTTGAGACCTACCAAGTT
CCCCGCAAGTATTATGAGAAGCACCCAGCCAAACCTCATTTGACGTTGGA
GGAGTACAAGGCTCAGTATCGTGAATCCATCGAGAACCCGGATAAATTTT
GGGGGGAGAAAGCGAGAGAACTTCTTCACTGGGATATTCCATTTCAGACC
GTAAGAAATGGATCCTTTCAGCATGGGGACATCAGCTGGTTCCTTGAGGG
CCGTTTGAACGCTTGCTACAATTGTGTCGACAGACATGCTTTCAAGGATC
CCGAGAGACCCGCGATTATCTACGAAGCCGACGAGCCGTCCGAAGGCCGC
GTGATCACATACAGTGAGCTCCTTCGTGAGGTATGCAAGTTGGCCTTTGT
CCTAAGGCAGATGGGTGTCAGGAAGGGAGATACCGTCGCCATTTACATGC
CCATGATCCCGGAGGCCCTGGTCGCATTCTTGGCAATCGTTAGAATCGGA
GCGGTTCACTCCGTCGTGTTTGCCGGGTTCTCGGCTGAATCTCTCCGCGA
TCGGGTTCTGGATGCGCGCTCCAAAGTGGTAATCACCACTGATGAGGGCA
AGCGCGGTGGAAAGGTTATCGGAACCAAGCGGATTGTGGACGACGCATTG
AAGCAATGCCCTGAAGTCAAGAACGTACTTGTCTACCGTCGTACCGGATC
GGAGGTGCCCTGGACCCAGGGTCGTGATTATTGGTGGCATGAGGAGGTCA
ACAAGTACCCCGGTTACTGTCCGCCTACCCTTATGGACTCAGAGGACCCC
TTGTTCCTGCTGTACACCTCCGGATCCACTGGAAAGCCTAAGGGTGTTAT
GCATACGACAGCTGGGTACCTTTTGGGCGCAGCCATGACGGGAAAGTACA
CCTTTGACCTTCATCCGGGCGATAAAATGGGAACGGCAGGGGACGTTGGC
TGGATTACGGGACACACATATGTGGTATATGCGCCACTATTGCTTGGTGT
TTCCACACTTGTTTTCGAGGGCACACCCGCATACCCGGATTTTTCGAGAT
ATTGGGATATCATCGAGAAGCACGGAATTACCCAATTCTATGTCGCACCA
ACCGCATTGAGGCTGTTGAAGAAGGCCGGCGACCACCACATCAACAAACA
GATGAAGACCCTGCGAGTATTGGGCTCAGTCGGTGAACCAATCGCTGAGG
ACGTGTGGAAGTGGTATCATGAGAAGGTTGGGCGTGGGGAATGCCATGTT
GTAGATACGTACTGGCAAACTGAGACCGGTTCTCACGCTATTGCGCCCAT
GGCTGGTGTTACTCCAACCAAACCTGGAAGTGCTACGCTTCCTTTCTTCG
GAATTGAACCCGCTATCATTGATCCGGTAACTGGTGATGAATTACACGGG
AACGGGGTTGAGGGAGTTTTGGCTATCAAGAGGCCATGGCCCAGTATGGC
GAGAACG

Sequences in the Contig:

SY0AAA14YH05FM1 SY0AAA18YO08FM1 SY0AAA36YB16FM1
SY0AAA44YL19FM1 SY0AAA46YO06FM1 SY0AAA50YD23FM1
SY0AAA6YH06FM1 SY0AAA9YO12FM1 SY0AAB10YA04FM1
SY0AAB16YM08FM1 SY0AAB2YA09FM1 SY0AAB51YN18FM1
SY0AAC11YA15FM1 SY0AAC11YH04FM1 SY0AAC11YM16FM1
SY0AAC13YD18FM1 SY0AAC15YP14FM1 SY0AAC16YO10FM1
SY0AAC18YA11FM1 SY0AAC18YI11FM1 SY0AAC19YF06FM1
SY0AAC1YB01FM1 SY0AAC1YJ16FM1 SY0AAC20YM09FM1
SY0AAC20YM20FM1 SY0AAC21YD08FM1 SY0AAC22YG12FM1
SY0AAC22YK24FM1 SY0AAC22YL15FM1 SY0AAC26YJ12FM1
SY0AAC29YB14FM1 SY0AAC2YH15FM1 SY0AAC30YI13FM1
SY0AAC30YI21FM1 SY0AAC32YE02FM1 SY0AAC36YF13FM1
SY0AAC36YM07FM1 SY0AAC38YE09FM1 SY0AAC39YA13FM1
SY0AAC3YA19FM1 SY0AAC3YN07FM1 SY0AAC3YP14FM1
SY0AAC40YN16FM1 SY0AAC42YA07FM1 SY0AAC42YO11FM1
SY0AAC43YB16FM1 SY0AAC44YP14FM1 SY0AAC46YA02FM1
SY0AAC46YK12FM1 SY0AAC47YJ04FM1 SY0AAC49YB04FM1
SY0AAC49YB06FM1 SY0AAC49YD10FM1 SY0AAC49YD21FM1
SY0AAC49YE11FM1 SY0AAC4YP17FM1 SY0AAC51YE23FM1
SY0AAC52YB04FM1 SY0AAC52YP11FM1 SY0AAC55YC15FM3
SY0AAC55YO15FM3 SY0AAC56YK16FM1 SY0AAC57YJ16FM1
SY0AAC59YO09FM1 SY0AAC60YF17FM1 SY0AAC60YI21FM1
SY0AAC61YA04FM1 SY0AAC61YD13FM1 SY0AAC61YP10FM1
SY0AAD10YD08FM1 SY0AAD14YG23FM1 SY0AAD14YJ20FM1
SY0AAD14YO23FM1 SY0AAD16YJ20FM1 SY0AAD18YG17FM1
SY0AAD19YJ07FM1 SY0AAD21YM22FM1 SY0AAD23YM02FM1
SY0AAD26YP11FM1 SY0AAD29YJ02FM1 SY0AAD30YO09FM1
SY0AAD32YB02FM1 SY0AAD34YG07FM1 SY0AAD35YE09FM1
SY0AAD35YJ01FM1 SY0AAD38YL02FM1 SY0AAD39YC02FM1
SY0AAD39YG06FM1 SY0AAD42YK07FM1 SY0AAD43YA23FM1
SY0AAD44YC18FM1 SY0AAD44YG21FM1 SY0AAD44YO13FM1
SY0AAD45YB03FM1 SY0AAD46YB10FM1 SY0AAD49YA21FM1
SY0AAD49YO19FM1 SY0AAD52YC11FM1 SY0AAD52YK16FM1
SY0AAD57YB03FM1 SY0AAD59YB17FM1 SY0AAD59YE24FM1
SY0AAD5YM22FM1 SY0AAD9YC18FM1