Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1215
Length(NT) : 1037
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1215
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCCTGTCCTGTTCCCCTC
CTCTGTTCTTCTTTCTTTCCCCCCTCCCTTTGAAAGACTACGAAAAGGCT
TCCTATCCGTAGTGCTTGCCATGAGCTGGGAAGCTCTAGGCTTAAGGCTC
GAGCCCATTGAGCTGACTTACTCTCCGCGCCGATCCAACTTGAGTTTGTC
TAAACTTGGCTCAGGTTATGAGAAGTCGAGGATTGGGAAATTAAGTTAAA
TGCATAGGAGAACTGCAAATAAAGGACGATCAGGTCTTCTACGAAAATAC
AGCCTACAATTCATTTCCTTTTTTCCCCTCTTTACATTTTCTACTTTAAA
TACCATTTTCTCTCCTCAGATTTCTACGGCTCCAGCCAGCTCAGGCTCGA
GCTTCATAAGAATTCTCAAGCACCTCGAGTCCATTTCCTTGCGAGTCAAG
CCGGCTCGAGTCCACCATGATAGAGTATGGTTCGACTCGAGCCGGCACCT
GACAAACACTACCTATCCATTTTGAGTCTTTGTGCGCACTCCCGCAATTA
GCCATCCAAGATGTTGTAGGGGAGTTCTCAGACCTTAGGCCCTCAAAGGA
GAATATAGGTCCCTCCCCTGGGCGGTGAAGGAGTTTGCTAGTTCCTCCAC
GACTAGCATTCGTCTTATACCGTACGAACTCGAATAATTGAACCTCACTC
TAAGACGTCCGAAAGCTCCTCTCGCCCGGATAAGGGGTGAAAACACTGCG
AAACGTGACCCCCGGGGCCCCAGTTTAAGACTGGGGAAAAAGTAATGGAA
TAGCCTCACCTTACCAGCAAAGGCAACTCCAATGTCCCAGCTCCAGGTTC
AATTATCCGAGTAATACGCAGGACCAGATAACAGAGCTGGACCAGCGGAT
TCTTGGACAGTCGAAGGGTTTTCTTTCACATATCCCAAGTTAGCTTACAG
TCTACTTATCTTGGTTATAGGAGTTGGGAGCCTTGATAACGAGGGTGGAG
ACGGGTCTTCGCGAATCGAGAACCCGATTACTTCCAT

Sequences in the Contig:

SY0AAA21YG06FM1 SY0AAA23YK08FM1 SY0AAA44YL17FM1
SY0AAC51YA10FM1 SY0AAD30YC06FM1